Incidental Mutation 'R4352:Gm11639'
ID327359
Institutional Source Beutler Lab
Gene Symbol Gm11639
Ensembl Gene ENSMUSG00000040838
Gene Namepredicted gene 11639
Synonyms
MMRRC Submission 041668-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R4352 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location104685707-105117394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104739314 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 957 (L957Q)
Ref Sequence ENSEMBL: ENSMUSP00000116040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000148007] [ENSMUST00000212287]
Predicted Effect probably null
Transcript: ENSMUST00000148007
AA Change: L957Q

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116040
Gene: ENSMUSG00000040838
AA Change: L957Q

DomainStartEndE-ValueType
low complexity region 40 55 N/A INTRINSIC
low complexity region 116 129 N/A INTRINSIC
internal_repeat_4 146 233 3.42e-6 PROSPERO
internal_repeat_3 165 247 2.21e-6 PROSPERO
low complexity region 331 348 N/A INTRINSIC
internal_repeat_2 349 361 4.38e-8 PROSPERO
internal_repeat_2 371 383 4.38e-8 PROSPERO
low complexity region 385 640 N/A INTRINSIC
Pfam:EF-hand_8 677 729 8.7e-6 PFAM
low complexity region 835 842 N/A INTRINSIC
internal_repeat_1 879 1106 2.47e-14 PROSPERO
internal_repeat_4 1015 1108 3.42e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000212287
Meta Mutation Damage Score 0.606 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (79/82)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abtb2 T A 2: 103,683,393 D382E possibly damaging Het
Adamts1 T A 16: 85,802,346 D122V probably benign Het
Ankrd54 A T 15: 79,055,462 F176I probably benign Het
Ano3 T A 2: 110,745,894 E94V possibly damaging Het
Arid1b A T 17: 5,097,584 Q587L possibly damaging Het
Atg2a G A 19: 6,257,457 V1474M probably benign Het
Bcl2a1d A G 9: 88,731,499 V74A probably damaging Het
Bmper A G 9: 23,483,952 I660V probably benign Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Cds2 T A 2: 132,263,445 M1K probably null Het
Ctr9 T A 7: 111,049,318 Y722N probably damaging Het
Ddx47 C T 6: 135,018,055 T161I probably benign Het
Dvl3 T C 16: 20,525,644 Y257H possibly damaging Het
Dzip1 T C 14: 118,883,526 D673G probably benign Het
Emilin2 T C 17: 71,280,731 M129V probably benign Het
Eml1 A T 12: 108,534,837 probably benign Het
Espnl A T 1: 91,334,721 D296V probably damaging Het
Fam161a T G 11: 23,020,798 S109R possibly damaging Het
Fat3 T G 9: 16,246,778 T1179P possibly damaging Het
Gfra1 A T 19: 58,267,024 N330K probably benign Het
Gfy T C 7: 45,177,616 E352G probably benign Het
Gm12569 A G 11: 51,234,819 N190D possibly damaging Het
Gm20775 A T Y: 10,641,648 noncoding transcript Het
Gm5885 T A 6: 133,531,189 noncoding transcript Het
Gpatch11 T C 17: 78,841,017 L128P probably damaging Het
H2-Q1 A G 17: 35,320,943 N63D possibly damaging Het
Itgb2 A T 10: 77,556,167 N358I probably benign Het
Jmjd1c A G 10: 67,244,809 T2247A probably damaging Het
Kcnma1 T A 14: 23,311,652 K1036I probably damaging Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrch1 G T 14: 74,818,578 S278R probably damaging Het
Lrp2 C A 2: 69,432,182 probably null Het
Lyn G A 4: 3,789,796 R443H probably damaging Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Mpzl1 G A 1: 165,605,807 Q36* probably null Het
Npr2 T C 4: 43,646,592 S647P probably damaging Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Otogl A T 10: 107,869,535 C644S probably damaging Het
Pabpc4 C T 4: 123,290,267 T191I probably damaging Het
Paqr3 T C 5: 97,099,596 T218A probably benign Het
Pcdh7 C T 5: 57,722,019 S972L possibly damaging Het
Pcnx2 T C 8: 125,762,851 H1668R probably damaging Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ralb A G 1: 119,483,552 M19T probably benign Het
Rcan1 A G 16: 92,393,496 I185T probably benign Het
Rnf38 A T 4: 44,149,100 N82K possibly damaging Het
Rock1 T A 18: 10,079,237 Q1077L probably damaging Het
Sesn3 C T 9: 14,320,373 A200V probably damaging Het
Shh T C 5: 28,458,189 E327G probably benign Het
Shmt2 G A 10: 127,518,817 A333V probably damaging Het
Slc15a2 T A 16: 36,772,028 I256F probably benign Het
Sptbn5 T C 2: 120,083,199 noncoding transcript Het
Sst A G 16: 23,889,815 S89P probably damaging Het
Taf10 A G 7: 105,743,407 probably benign Het
Tas2r139 T A 6: 42,141,755 W274R probably damaging Het
Tbc1d20 T A 2: 152,308,194 probably benign Het
Tbc1d5 A G 17: 50,782,401 S584P probably damaging Het
Tcstv1 T C 13: 119,893,871 D75G probably damaging Het
Tex10 T G 4: 48,452,039 T696P possibly damaging Het
Tgfbr1 T C 4: 47,402,863 F206S probably damaging Het
Tmem241 A T 18: 12,113,439 H51Q probably benign Het
Trim5 A T 7: 104,276,808 V182D probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl1 A G 18: 63,671,679 V248A possibly damaging Het
Ubr5 A G 15: 38,041,573 V204A probably benign Het
Ugp2 C T 11: 21,329,026 V387I probably damaging Het
Unc45b G A 11: 82,913,209 D71N probably damaging Het
Usp34 A T 11: 23,320,727 Y37F possibly damaging Het
Zfp943 A T 17: 21,993,123 I397F probably damaging Het
Other mutations in Gm11639
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Gm11639 APN 11 105100021 missense probably damaging 1.00
IGL01308:Gm11639 APN 11 104720697 missense probably benign 0.03
IGL01483:Gm11639 APN 11 104739347 missense probably benign 0.03
IGL01695:Gm11639 APN 11 104736063 missense probably damaging 1.00
IGL01860:Gm11639 APN 11 104690921 missense probably benign 0.16
IGL01981:Gm11639 APN 11 104721432 intron probably benign
IGL01984:Gm11639 APN 11 104738308 missense probably benign 0.20
IGL02023:Gm11639 APN 11 104721432 intron probably benign
IGL02252:Gm11639 APN 11 104753927 missense possibly damaging 0.68
IGL02886:Gm11639 APN 11 105095874 missense possibly damaging 0.95
IGL03116:Gm11639 APN 11 104721533 missense probably benign 0.02
IGL03141:Gm11639 APN 11 105095870 missense probably damaging 0.99
IGL03242:Gm11639 APN 11 105106404 missense probably damaging 1.00
IGL03274:Gm11639 APN 11 104721093 missense probably benign 0.03
IGL03408:Gm11639 APN 11 104710621 missense probably benign 0.03
R0018:Gm11639 UTSW 11 104721552 critical splice donor site probably null
R0068:Gm11639 UTSW 11 104720822 missense probably benign 0.29
R0350:Gm11639 UTSW 11 104690880 missense probably benign 0.03
R0646:Gm11639 UTSW 11 104720501 missense probably benign 0.03
R0668:Gm11639 UTSW 11 104720492 missense probably benign 0.16
R0715:Gm11639 UTSW 11 104720880 missense possibly damaging 0.90
R0944:Gm11639 UTSW 11 104710730 splice site probably null
R1330:Gm11639 UTSW 11 104746290 missense possibly damaging 0.84
R1508:Gm11639 UTSW 11 104710677 missense probably benign 0.03
R1643:Gm11639 UTSW 11 104698978 missense probably benign 0.16
R1651:Gm11639 UTSW 11 104720666 missense probably benign 0.03
R1665:Gm11639 UTSW 11 104721114 missense probably benign 0.07
R1702:Gm11639 UTSW 11 104691006 missense probably benign 0.03
R1711:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1779:Gm11639 UTSW 11 104720939 missense probably benign 0.15
R1813:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1818:Gm11639 UTSW 11 104721507 missense probably benign 0.10
R1896:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1969:Gm11639 UTSW 11 104746264 missense probably damaging 1.00
R2139:Gm11639 UTSW 11 104751911 missense possibly damaging 0.53
R2165:Gm11639 UTSW 11 104751862 missense possibly damaging 0.93
R2359:Gm11639 UTSW 11 104739280 missense possibly damaging 0.80
R2394:Gm11639 UTSW 11 104738295 missense probably benign 0.17
R2406:Gm11639 UTSW 11 104720631 missense probably benign 0.03
R2570:Gm11639 UTSW 11 104733664 missense probably damaging 1.00
R3795:Gm11639 UTSW 11 104733675 missense possibly damaging 0.94
R4359:Gm11639 UTSW 11 104733721 splice site probably null
R4424:Gm11639 UTSW 11 104736114 critical splice donor site probably null
R4895:Gm11639 UTSW 11 104720286 missense probably benign 0.16
R4895:Gm11639 UTSW 11 104749670 missense probably damaging 1.00
R5006:Gm11639 UTSW 11 104729677 splice site probably null
R5066:Gm11639 UTSW 11 104720664 missense probably benign 0.03
R5329:Gm11639 UTSW 11 104753806 intron probably null
R5405:Gm11639 UTSW 11 104721192 missense probably benign 0.07
R5814:Gm11639 UTSW 11 104736114 critical splice donor site probably benign
R5888:Gm11639 UTSW 11 104721401 splice site probably benign
R5910:Gm11639 UTSW 11 104690934 missense probably benign 0.01
R5975:Gm11639 UTSW 11 104687549 start gained probably benign
R6019:Gm11639 UTSW 11 105042902 critical splice donor site probably null
R6028:Gm11639 UTSW 11 104769655 critical splice donor site probably null
R6048:Gm11639 UTSW 11 104944433 missense unknown
R6059:Gm11639 UTSW 11 105036769 missense probably benign 0.03
R6147:Gm11639 UTSW 11 104967740 missense unknown
R6176:Gm11639 UTSW 11 104792557 missense probably benign 0.16
R6181:Gm11639 UTSW 11 104831333 missense probably benign 0.25
R6196:Gm11639 UTSW 11 104855560 missense probably benign 0.07
R6245:Gm11639 UTSW 11 104785008 missense probably benign 0.03
R6262:Gm11639 UTSW 11 104893753 missense probably benign 0.24
R6263:Gm11639 UTSW 11 104919486 missense unknown
R6277:Gm11639 UTSW 11 105010322 missense possibly damaging 0.49
R6338:Gm11639 UTSW 11 104843208 nonsense probably null
R6355:Gm11639 UTSW 11 105005685 missense probably benign 0.29
R6356:Gm11639 UTSW 11 104893707 missense probably benign 0.19
R6365:Gm11639 UTSW 11 104924586 missense unknown
R6391:Gm11639 UTSW 11 104994317 missense possibly damaging 0.92
R6556:Gm11639 UTSW 11 105008251 missense probably null 0.03
R6604:Gm11639 UTSW 11 104698946 nonsense probably null
R6605:Gm11639 UTSW 11 104999281 splice site probably null
R6634:Gm11639 UTSW 11 104893783 missense probably benign 0.17
R6851:Gm11639 UTSW 11 105005695 missense probably benign 0.03
R6862:Gm11639 UTSW 11 104721458 nonsense probably null
R6949:Gm11639 UTSW 11 104909070 missense probably damaging 1.00
R6970:Gm11639 UTSW 11 104776356 missense probably benign 0.03
R7014:Gm11639 UTSW 11 104693422 missense probably benign 0.03
R7097:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R7122:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R7124:Gm11639 UTSW 11 104738274 missense probably benign 0.17
R7146:Gm11639 UTSW 11 104967752 missense unknown
R7146:Gm11639 UTSW 11 105022938 missense probably benign 0.03
R7154:Gm11639 UTSW 11 104699140 intron probably null
R7175:Gm11639 UTSW 11 104947411 missense unknown
R7198:Gm11639 UTSW 11 104751885 missense probably benign 0.15
R7211:Gm11639 UTSW 11 104710713 missense probably benign 0.01
R7211:Gm11639 UTSW 11 104724609 critical splice donor site probably null
R7216:Gm11639 UTSW 11 104880549 missense possibly damaging 0.49
R7221:Gm11639 UTSW 11 104900606 missense probably benign 0.36
R7233:Gm11639 UTSW 11 104839843 missense possibly damaging 0.69
R7236:Gm11639 UTSW 11 104899267 missense probably benign 0.10
R7262:Gm11639 UTSW 11 104854606 critical splice donor site probably null
R7289:Gm11639 UTSW 11 105038358 missense probably benign 0.24
R7323:Gm11639 UTSW 11 105030011 missense probably benign 0.07
R7378:Gm11639 UTSW 11 104714702 missense probably benign 0.03
R7388:Gm11639 UTSW 11 104721045 missense probably damaging 0.97
R7390:Gm11639 UTSW 11 104724585 missense possibly damaging 0.46
R7411:Gm11639 UTSW 11 104999723 missense probably benign 0.10
R7468:Gm11639 UTSW 11 104749700 missense probably benign 0.17
R7497:Gm11639 UTSW 11 104762690 critical splice donor site probably null
X0026:Gm11639 UTSW 11 104720975 missense probably benign 0.07
Z1088:Gm11639 UTSW 11 104751902 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGCTGCCAACAAATTCAAATGG -3'
(R):5'- AGCACCACTATCAGGCAAGTTC -3'

Sequencing Primer
(F):5'- CTGCCAACAAATTCAAATGGACTTTG -3'
(R):5'- ACCACTATCAGGCAAGTTCTCTCTC -3'
Posted On2015-07-07