Mutagenetix > Incidental Mutation

Incidental Mutation 'R4352:Sst'

327369

Institutional Source

Beutler Lab

Gene Symbol

Sst

Ensembl Gene

ENSMUSG00000004366

Gene Name

somatostatin

Synonyms

Smst, preprosomatostatin, SRIF, SOM

MMRRC Submission

041668-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4352 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

23708323-23709708 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 23708565 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 89 (S89P)

Ref Sequence

ENSEMBL: ENSMUSP00000004480 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004480]

AlphaFold

P60041

Predicted Effect

probably damaging
Transcript: ENSMUST00000004480
AA Change: S89P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000004480
Gene: ENSMUSG00000004366
AA Change: S89P

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Somatostatin	99	116	5.9e-15	PFAM

Meta Mutation Damage Score

0.1174

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

96% (79/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The hormone somatostatin has active 14 aa and 28 aa forms that are produced by alternate cleavage of the single preproprotein encoded by this gene. Somatostatin is expressed throughout the body and inhibits the release of numerous secondary hormones by binding to high-affinity G-protein-coupled somatostatin receptors. This hormone is an important regulator of the endocrine system through its interactions with pituitary growth hormone, thyroid stimulating hormone, and most hormones of the gastrointestinal tract. Somatostatin also affects rates of neurotransmission in the central nervous system and proliferation of both normal and tumorigenic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show altered GH secretory dynamics, hypergastremia, and reduced hippocampal bursting and excitatory transmission. Mice homozygous for another null allele show impaired motor learning, higher GH and corticosterone levels,gastric fundus hyperplasia and hyperacidity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	C	T	6: 128,557,349 (GRCm39)	A115T	probably benign	Het
Abtb2	T	A	2: 103,513,738 (GRCm39)	D382E	possibly damaging	Het
Adamts1	T	A	16: 85,599,234 (GRCm39)	D122V	probably benign	Het
Ankrd54	A	T	15: 78,939,662 (GRCm39)	F176I	probably benign	Het
Ano3	T	A	2: 110,576,239 (GRCm39)	E94V	possibly damaging	Het
Arid1b	A	T	17: 5,147,859 (GRCm39)	Q587L	possibly damaging	Het
Atg2a	G	A	19: 6,307,487 (GRCm39)	V1474M	probably benign	Het
Bcl2a1d	A	G	9: 88,613,552 (GRCm39)	V74A	probably damaging	Het
Bmper	A	G	9: 23,395,248 (GRCm39)	I660V	probably benign	Het
Cdh20	A	G	1: 104,906,814 (GRCm39)	D547G	probably damaging	Het
Cds2	T	A	2: 132,105,365 (GRCm39)	M1K	probably null	Het
Ctr9	T	A	7: 110,648,525 (GRCm39)	Y722N	probably damaging	Het
Ddx47	C	T	6: 134,995,018 (GRCm39)	T161I	probably benign	Het
Dvl3	T	C	16: 20,344,394 (GRCm39)	Y257H	possibly damaging	Het
Dzip1	T	C	14: 119,120,938 (GRCm39)	D673G	probably benign	Het
Efcab3	T	A	11: 104,630,140 (GRCm39)	L957Q	probably null	Het
Emilin2	T	C	17: 71,587,726 (GRCm39)	M129V	probably benign	Het
Eml1	A	T	12: 108,501,096 (GRCm39)		probably benign	Het
Espnl	A	T	1: 91,262,443 (GRCm39)	D296V	probably damaging	Het
Fam161a	T	G	11: 22,970,798 (GRCm39)	S109R	possibly damaging	Het
Fat3	T	G	9: 16,158,074 (GRCm39)	T1179P	possibly damaging	Het
Gfra1	A	T	19: 58,255,456 (GRCm39)	N330K	probably benign	Het
Gfy	T	C	7: 44,827,040 (GRCm39)	E352G	probably benign	Het
Gm20775	A	T	Y: 10,641,648 (GRCm39)		noncoding transcript	Het
Gm5885	T	A	6: 133,508,152 (GRCm39)		noncoding transcript	Het
Gpatch11	T	C	17: 79,148,446 (GRCm39)	L128P	probably damaging	Het
H2-Q1	A	G	17: 35,539,919 (GRCm39)	N63D	possibly damaging	Het
Itgb2	A	T	10: 77,392,001 (GRCm39)	N358I	probably benign	Het
Jmjd1c	A	G	10: 67,080,588 (GRCm39)	T2247A	probably damaging	Het
Kcnma1	T	A	14: 23,361,720 (GRCm39)	K1036I	probably damaging	Het
Llgl1	C	T	11: 60,600,394 (GRCm39)	P581L	probably benign	Het
Lrch1	G	T	14: 75,056,018 (GRCm39)	S278R	probably damaging	Het
Lrp2	C	A	2: 69,262,526 (GRCm39)		probably null	Het
Lyn	G	A	4: 3,789,796 (GRCm39)	R443H	probably damaging	Het
Mecom	C	A	3: 30,020,887 (GRCm39)	V452L	possibly damaging	Het
Mpzl1	G	A	1: 165,433,376 (GRCm39)	Q36*	probably null	Het
Msantd5	A	G	11: 51,125,646 (GRCm39)	N190D	possibly damaging	Het
Npr2	T	C	4: 43,646,592 (GRCm39)	S647P	probably damaging	Het
Nrp2	A	G	1: 62,777,576 (GRCm39)	D127G	probably damaging	Het
Otogl	A	T	10: 107,705,396 (GRCm39)	C644S	probably damaging	Het
Pabpc4	C	T	4: 123,184,060 (GRCm39)	T191I	probably damaging	Het
Paqr3	T	C	5: 97,247,455 (GRCm39)	T218A	probably benign	Het
Pcdh7	C	T	5: 57,879,361 (GRCm39)	S972L	possibly damaging	Het
Pcnx2	T	C	8: 126,489,590 (GRCm39)	H1668R	probably damaging	Het
Prb1b	T	G	6: 132,290,624 (GRCm39)	Y25S	unknown	Het
Ralb	A	G	1: 119,411,282 (GRCm39)	M19T	probably benign	Het
Rcan1	A	G	16: 92,190,384 (GRCm39)	I185T	probably benign	Het
Rnf38	A	T	4: 44,149,100 (GRCm39)	N82K	possibly damaging	Het
Rock1	T	A	18: 10,079,237 (GRCm39)	Q1077L	probably damaging	Het
Sesn3	C	T	9: 14,231,669 (GRCm39)	A200V	probably damaging	Het
Shh	T	C	5: 28,663,187 (GRCm39)	E327G	probably benign	Het
Shmt2	G	A	10: 127,354,686 (GRCm39)	A333V	probably damaging	Het
Slc15a2	T	A	16: 36,592,390 (GRCm39)	I256F	probably benign	Het
Sptbn5	T	C	2: 119,913,680 (GRCm39)		noncoding transcript	Het
Taf10	A	G	7: 105,392,614 (GRCm39)		probably benign	Het
Tas2r139	T	A	6: 42,118,689 (GRCm39)	W274R	probably damaging	Het
Tbc1d20	T	A	2: 152,150,114 (GRCm39)		probably benign	Het
Tbc1d5	A	G	17: 51,089,429 (GRCm39)	S584P	probably damaging	Het
Tcstv1a	T	C	13: 120,355,407 (GRCm39)	D75G	probably damaging	Het
Tex10	T	G	4: 48,452,039 (GRCm39)	T696P	possibly damaging	Het
Tgfbr1	T	C	4: 47,402,863 (GRCm39)	F206S	probably damaging	Het
Tmem241	A	T	18: 12,246,496 (GRCm39)	H51Q	probably benign	Het
Trim5	A	T	7: 103,926,015 (GRCm39)	V182D	probably damaging	Het
Ttn	A	T	2: 76,641,587 (GRCm39)	L5176Q	possibly damaging	Het
Txnl1	A	G	18: 63,804,750 (GRCm39)	V248A	possibly damaging	Het
Ubr5	A	G	15: 38,041,817 (GRCm39)	V204A	probably benign	Het
Ugp2	C	T	11: 21,279,026 (GRCm39)	V387I	probably damaging	Het
Unc45b	G	A	11: 82,804,035 (GRCm39)	D71N	probably damaging	Het
Usp34	A	T	11: 23,270,727 (GRCm39)	Y37F	possibly damaging	Het
Zfp943	A	T	17: 22,212,104 (GRCm39)	I397F	probably damaging	Het

Other mutations in Sst

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R1472:Sst	UTSW	16	23,709,448 (GRCm39)	missense	probably benign
R1853:Sst	UTSW	16	23,709,403 (GRCm39)	missense	probably damaging	1.00
R2209:Sst	UTSW	16	23,708,558 (GRCm39)	missense	probably benign	0.05
R3919:Sst	UTSW	16	23,708,591 (GRCm39)	missense	possibly damaging	0.59
R4350:Sst	UTSW	16	23,708,565 (GRCm39)	missense	probably damaging	0.99
R4351:Sst	UTSW	16	23,708,565 (GRCm39)	missense	probably damaging	0.99
R5586:Sst	UTSW	16	23,708,487 (GRCm39)	missense	probably damaging	1.00
R6844:Sst	UTSW	16	23,708,592 (GRCm39)	missense	probably benign	0.00
R7492:Sst	UTSW	16	23,708,576 (GRCm39)	missense	probably damaging	1.00
R8903:Sst	UTSW	16	23,708,499 (GRCm39)	nonsense	probably null
R9417:Sst	UTSW	16	23,708,487 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGGTCAAGTTGAGCATCGG -3'
(R):5'- CCCATATGATTGTGAAAACTGGG -3'

Sequencing Primer
(F):5'- AAGTTGAGCATCGGGGGCC -3'
(R):5'- CATATGATTGTGAAAACTGGGTTTTG -3'

Posted On

2015-07-07