Incidental Mutation 'R4353:Stk36'
List |< first << previous [record 47 of 52] next >> last >|
ID327386
Institutional Source Beutler Lab
Gene Symbol Stk36
Ensembl Gene ENSMUSG00000033276
Gene Nameserine/threonine kinase 36
Synonyms1700112N14Rik, Fused
MMRRC Submission 040866-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4353 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location74601445-74636894 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74632807 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 889 (R889G)
Ref Sequence ENSEMBL: ENSMUSP00000120020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087183] [ENSMUST00000087186] [ENSMUST00000148456]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087183
AA Change: R891G

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000084430
Gene: ENSMUSG00000033276
AA Change: R891G

DomainStartEndE-ValueType
S_TKc 4 254 5.24e-100 SMART
low complexity region 405 419 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
low complexity region 705 718 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 852 860 N/A INTRINSIC
low complexity region 900 914 N/A INTRINSIC
low complexity region 956 969 N/A INTRINSIC
low complexity region 994 1009 N/A INTRINSIC
low complexity region 1014 1030 N/A INTRINSIC
Pfam:HEAT_2 1112 1218 7.8e-11 PFAM
Pfam:HEAT_2 1158 1259 3e-11 PFAM
Pfam:HEAT_EZ 1207 1261 4.3e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000087186
AA Change: R763G
SMART Domains Protein: ENSMUSP00000084433
Gene: ENSMUSG00000033276
AA Change: R763G

DomainStartEndE-ValueType
S_TKc 4 254 5.24e-100 SMART
low complexity region 405 419 N/A INTRINSIC
low complexity region 577 590 N/A INTRINSIC
low complexity region 698 708 N/A INTRINSIC
low complexity region 724 732 N/A INTRINSIC
low complexity region 772 786 N/A INTRINSIC
low complexity region 828 841 N/A INTRINSIC
low complexity region 866 881 N/A INTRINSIC
low complexity region 886 902 N/A INTRINSIC
Pfam:HEAT_2 984 1090 2.9e-10 PFAM
Pfam:HEAT_2 1026 1131 9.6e-11 PFAM
Pfam:HEAT_EZ 1039 1092 2.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145673
Predicted Effect possibly damaging
Transcript: ENSMUST00000148456
AA Change: R889G

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120020
Gene: ENSMUSG00000033276
AA Change: R889G

DomainStartEndE-ValueType
S_TKc 4 254 5.24e-100 SMART
low complexity region 405 419 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
low complexity region 705 718 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 852 860 N/A INTRINSIC
low complexity region 898 912 N/A INTRINSIC
low complexity region 954 967 N/A INTRINSIC
low complexity region 992 1007 N/A INTRINSIC
low complexity region 1012 1028 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155473
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine kinase family of enzymes. This family member is similar to a Drosophila protein that plays a key role in the Hedgehog signaling pathway. This human protein is a positive regulator of the GLI zinc-finger transcription factors. Knockout studies of the homologous mouse gene suggest that defects in this human gene may lead to congenital hydrocephalus, possibly due to a functional defect in motile cilia. Because Hedgehog signaling is frequently activated in certain kinds of gastrointestinal cancers, it has been suggested that this gene is a target for the treatment of these cancers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Nullizygous mutations cause postnatal growth defects and lethality. Homozygotes for a null allele show hydrocephaly, cranial defects, otitis media and sterility. Homozygotes for another null allele show additional defects in lung and renal development, thymus and spleen atrophy, rhinitis and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T C 13: 105,118,745 Y445H probably benign Het
5730559C18Rik C T 1: 136,226,208 V180I probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpk2 C T 18: 65,291,452 R1888H possibly damaging Het
Arhgap33 C A 7: 30,524,136 V823L possibly damaging Het
Atp2b2 T C 6: 113,765,784 I736V probably benign Het
Atp8a1 T C 5: 67,769,108 T260A probably damaging Het
B4galnt3 T C 6: 120,215,476 E433G possibly damaging Het
Bzw2 A T 12: 36,123,979 F99I probably damaging Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Col27a1 G T 4: 63,225,631 A519S probably benign Het
Coq6 G A 12: 84,368,149 G110D probably damaging Het
Cpb1 T C 3: 20,262,544 T281A probably benign Het
Cttnbp2 T C 6: 18,514,704 D11G probably benign Het
Cyp2c37 A G 19: 40,000,545 Y316C possibly damaging Het
Dcdc2a T A 13: 25,056,491 I74N probably damaging Het
Dhx9 A G 1: 153,471,789 L391P probably damaging Het
Dsc2 G T 18: 20,050,068 L98I probably damaging Het
Dthd1 T A 5: 62,842,867 S511T probably benign Het
Dusp2 A G 2: 127,337,336 T204A probably damaging Het
Elovl5 T C 9: 77,960,917 V37A probably benign Het
Etv1 A G 12: 38,857,106 E369G probably damaging Het
Gem G A 4: 11,705,939 R9H probably damaging Het
Heg1 A G 16: 33,710,477 T108A probably benign Het
Iqgap2 C T 13: 95,671,396 V788M probably damaging Het
Kyat3 T C 3: 142,731,293 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Meis2 A G 2: 116,059,563 M146T probably damaging Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Nup214 T C 2: 31,977,917 probably null Het
Olfr93 T A 17: 37,151,337 I58F probably damaging Het
Pabpc4 C T 4: 123,290,267 T191I probably damaging Het
Pcnx2 T C 8: 125,762,851 H1668R probably damaging Het
Poln C T 5: 34,129,452 C124Y probably benign Het
Ppp2r2a T A 14: 67,028,937 I92L probably damaging Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Rnf130 T C 11: 50,087,440 V276A possibly damaging Het
Rnf31 AAC A 14: 55,601,098 probably null Het
Rnf38 A T 4: 44,149,100 N82K possibly damaging Het
Scn7a T A 2: 66,676,436 M1370L probably benign Het
Sema4b C A 7: 80,215,651 L125I probably damaging Het
Slc12a7 C T 13: 73,790,734 T210I possibly damaging Het
Sox8 A C 17: 25,567,335 *465G probably null Het
Spg11 G T 2: 122,113,194 T159K possibly damaging Het
Tmbim7 A G 5: 3,661,796 S14G probably benign Het
Usp16 A G 16: 87,470,354 N211D probably damaging Het
Vmn1r6 C T 6: 57,002,692 A113V possibly damaging Het
Zc3h14 A G 12: 98,763,960 N92D possibly damaging Het
Zfp638 T C 6: 83,984,059 S1206P probably damaging Het
Other mutations in Stk36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Stk36 APN 1 74634702 missense possibly damaging 0.82
IGL00485:Stk36 APN 1 74634085 missense probably benign
IGL00792:Stk36 APN 1 74611117 missense probably benign 0.01
IGL00941:Stk36 APN 1 74623934 missense possibly damaging 0.85
IGL01324:Stk36 APN 1 74625610 missense possibly damaging 0.66
IGL01538:Stk36 APN 1 74633638 missense probably benign 0.03
IGL02143:Stk36 APN 1 74616569 splice site probably benign
IGL02223:Stk36 APN 1 74623337 missense possibly damaging 0.84
IGL02371:Stk36 APN 1 74622255 missense probably benign 0.13
IGL02618:Stk36 APN 1 74631675 splice site probably benign
IGL02655:Stk36 APN 1 74634535 missense probably damaging 1.00
IGL02993:Stk36 APN 1 74622287 missense probably benign 0.05
IGL03125:Stk36 APN 1 74623313 missense probably damaging 1.00
IGL03242:Stk36 APN 1 74623352 missense possibly damaging 0.70
R0373:Stk36 UTSW 1 74633620 missense probably damaging 0.99
R0377:Stk36 UTSW 1 74612730 missense probably benign
R0464:Stk36 UTSW 1 74611172 missense probably damaging 0.98
R0520:Stk36 UTSW 1 74602206 unclassified probably benign
R0551:Stk36 UTSW 1 74616621 missense probably benign 0.00
R1118:Stk36 UTSW 1 74632766 missense probably benign 0.29
R1119:Stk36 UTSW 1 74632766 missense probably benign 0.29
R1471:Stk36 UTSW 1 74611155 missense probably benign 0.14
R1915:Stk36 UTSW 1 74634187 missense probably benign 0.08
R2159:Stk36 UTSW 1 74634737 missense probably benign 0.00
R2290:Stk36 UTSW 1 74626144 splice site probably benign
R2897:Stk36 UTSW 1 74632825 missense probably null
R2898:Stk36 UTSW 1 74632825 missense probably null
R4032:Stk36 UTSW 1 74626048 missense probably benign
R4683:Stk36 UTSW 1 74634185 missense probably benign 0.22
R4753:Stk36 UTSW 1 74626096 missense probably benign 0.05
R4891:Stk36 UTSW 1 74603256 missense probably damaging 1.00
R5068:Stk36 UTSW 1 74622345 missense probably benign 0.00
R5115:Stk36 UTSW 1 74635827 missense probably damaging 1.00
R5266:Stk36 UTSW 1 74611158 missense probably benign
R5412:Stk36 UTSW 1 74605456 unclassified probably null
R5533:Stk36 UTSW 1 74626591 missense possibly damaging 0.65
R5782:Stk36 UTSW 1 74605425 missense possibly damaging 0.81
R6149:Stk36 UTSW 1 74634229 missense probably benign 0.00
R6208:Stk36 UTSW 1 74611432 missense probably benign 0.03
R6497:Stk36 UTSW 1 74603232 missense probably damaging 1.00
R6805:Stk36 UTSW 1 74622239 missense probably benign
R7064:Stk36 UTSW 1 74610820 missense probably damaging 1.00
R7102:Stk36 UTSW 1 74622223 missense probably benign 0.10
R7393:Stk36 UTSW 1 74611193 nonsense probably null
R7408:Stk36 UTSW 1 74633566 missense probably damaging 1.00
R7471:Stk36 UTSW 1 74634320 missense unknown
R7816:Stk36 UTSW 1 74611169 nonsense probably null
R8019:Stk36 UTSW 1 74612766
Predicted Primers PCR Primer
(F):5'- AGATGAAAGGATGGTTTCTGTGAC -3'
(R):5'- AGCAGCTCCATCATAGTCCC -3'

Sequencing Primer
(F):5'- CTCTGTGTCCAGGATAGAGATAAC -3'
(R):5'- CTGCACACAGTAGAAGCAATTATCTG -3'
Posted On2015-07-07