Incidental Mutation 'R4353:5730559C18Rik'
List |< first << previous [record 2 of 52] next >> last >|
ID327388
Institutional Source Beutler Lab
Gene Symbol 5730559C18Rik
Ensembl Gene ENSMUSG00000041605
Gene NameRIKEN cDNA 5730559C18 gene
Synonyms
MMRRC Submission 040866-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4353 (G1)
Quality Score202
Status Not validated
Chromosome1
Chromosomal Location136213531-136234264 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 136226208 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 180 (V180I)
Ref Sequence ENSEMBL: ENSMUSP00000113785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120339] [ENSMUST00000144464] [ENSMUST00000150163] [ENSMUST00000153910] [ENSMUST00000195177]
Predicted Effect probably damaging
Transcript: ENSMUST00000120339
AA Change: V180I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113785
Gene: ENSMUSG00000041605
AA Change: V180I

DomainStartEndE-ValueType
low complexity region 25 65 N/A INTRINSIC
Pfam:DUF3338 101 230 6.2e-57 PFAM
low complexity region 273 316 N/A INTRINSIC
low complexity region 353 362 N/A INTRINSIC
low complexity region 466 489 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000144464
AA Change: V81I

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115554
Gene: ENSMUSG00000041605
AA Change: V81I

DomainStartEndE-ValueType
Pfam:DUF3338 1 132 5.7e-58 PFAM
low complexity region 174 194 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000150163
AA Change: V81I

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118074
Gene: ENSMUSG00000041605
AA Change: V81I

DomainStartEndE-ValueType
Pfam:DUF3338 1 132 6.8e-58 PFAM
low complexity region 174 194 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153910
SMART Domains Protein: ENSMUSP00000120263
Gene: ENSMUSG00000041605

DomainStartEndE-ValueType
low complexity region 25 65 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194374
Predicted Effect probably benign
Transcript: ENSMUST00000195177
SMART Domains Protein: ENSMUSP00000141506
Gene: ENSMUSG00000041605

DomainStartEndE-ValueType
Pfam:DUF3338 1 78 5.2e-31 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T C 13: 105,118,745 Y445H probably benign Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpk2 C T 18: 65,291,452 R1888H possibly damaging Het
Arhgap33 C A 7: 30,524,136 V823L possibly damaging Het
Atp2b2 T C 6: 113,765,784 I736V probably benign Het
Atp8a1 T C 5: 67,769,108 T260A probably damaging Het
B4galnt3 T C 6: 120,215,476 E433G possibly damaging Het
Bzw2 A T 12: 36,123,979 F99I probably damaging Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Col27a1 G T 4: 63,225,631 A519S probably benign Het
Coq6 G A 12: 84,368,149 G110D probably damaging Het
Cpb1 T C 3: 20,262,544 T281A probably benign Het
Cttnbp2 T C 6: 18,514,704 D11G probably benign Het
Cyp2c37 A G 19: 40,000,545 Y316C possibly damaging Het
Dcdc2a T A 13: 25,056,491 I74N probably damaging Het
Dhx9 A G 1: 153,471,789 L391P probably damaging Het
Dsc2 G T 18: 20,050,068 L98I probably damaging Het
Dthd1 T A 5: 62,842,867 S511T probably benign Het
Dusp2 A G 2: 127,337,336 T204A probably damaging Het
Elovl5 T C 9: 77,960,917 V37A probably benign Het
Etv1 A G 12: 38,857,106 E369G probably damaging Het
Gem G A 4: 11,705,939 R9H probably damaging Het
Heg1 A G 16: 33,710,477 T108A probably benign Het
Iqgap2 C T 13: 95,671,396 V788M probably damaging Het
Kyat3 T C 3: 142,731,293 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Meis2 A G 2: 116,059,563 M146T probably damaging Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Nup214 T C 2: 31,977,917 probably null Het
Olfr93 T A 17: 37,151,337 I58F probably damaging Het
Pabpc4 C T 4: 123,290,267 T191I probably damaging Het
Pcnx2 T C 8: 125,762,851 H1668R probably damaging Het
Poln C T 5: 34,129,452 C124Y probably benign Het
Ppp2r2a T A 14: 67,028,937 I92L probably damaging Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Rnf130 T C 11: 50,087,440 V276A possibly damaging Het
Rnf31 AAC A 14: 55,601,098 probably null Het
Rnf38 A T 4: 44,149,100 N82K possibly damaging Het
Scn7a T A 2: 66,676,436 M1370L probably benign Het
Sema4b C A 7: 80,215,651 L125I probably damaging Het
Slc12a7 C T 13: 73,790,734 T210I possibly damaging Het
Sox8 A C 17: 25,567,335 *465G probably null Het
Spg11 G T 2: 122,113,194 T159K possibly damaging Het
Stk36 A G 1: 74,632,807 R889G possibly damaging Het
Tmbim7 A G 5: 3,661,796 S14G probably benign Het
Usp16 A G 16: 87,470,354 N211D probably damaging Het
Vmn1r6 C T 6: 57,002,692 A113V possibly damaging Het
Zc3h14 A G 12: 98,763,960 N92D possibly damaging Het
Zfp638 T C 6: 83,984,059 S1206P probably damaging Het
Other mutations in 5730559C18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:5730559C18Rik APN 1 136219775 missense probably damaging 1.00
IGL02466:5730559C18Rik APN 1 136216435 unclassified probably null
IGL03408:5730559C18Rik APN 1 136214405 missense probably benign
R0053:5730559C18Rik UTSW 1 136227550 missense probably benign 0.01
R0053:5730559C18Rik UTSW 1 136227550 missense probably benign 0.01
R0632:5730559C18Rik UTSW 1 136227618 missense probably benign 0.06
R1218:5730559C18Rik UTSW 1 136214402 missense probably damaging 1.00
R1611:5730559C18Rik UTSW 1 136216117 missense probably damaging 1.00
R3618:5730559C18Rik UTSW 1 136214372 missense probably benign 0.11
R4256:5730559C18Rik UTSW 1 136214350 missense probably benign 0.00
R4348:5730559C18Rik UTSW 1 136226208 missense probably damaging 1.00
R4350:5730559C18Rik UTSW 1 136226208 missense probably damaging 1.00
R5343:5730559C18Rik UTSW 1 136225442 missense probably benign 0.01
R6296:5730559C18Rik UTSW 1 136221071 critical splice donor site probably null
R6597:5730559C18Rik UTSW 1 136226189 missense probably damaging 1.00
R6983:5730559C18Rik UTSW 1 136220156 missense possibly damaging 0.59
R7060:5730559C18Rik UTSW 1 136220197 missense possibly damaging 0.75
R7503:5730559C18Rik UTSW 1 136215937 missense possibly damaging 0.76
R7527:5730559C18Rik UTSW 1 136214384 missense possibly damaging 0.67
R7602:5730559C18Rik UTSW 1 136225397 nonsense probably null
R7675:5730559C18Rik UTSW 1 136216003 missense probably benign 0.04
R7756:5730559C18Rik UTSW 1 136216433 missense probably benign 0.01
R7912:5730559C18Rik UTSW 1 136227541 missense probably benign 0.03
R7993:5730559C18Rik UTSW 1 136227541 missense probably benign 0.03
X0017:5730559C18Rik UTSW 1 136220182 missense probably damaging 1.00
Z1176:5730559C18Rik UTSW 1 136219783 missense not run
Predicted Primers PCR Primer
(F):5'- CATGCCTACTCAGAGCCATC -3'
(R):5'- AAGTGTCCCGCCATTTTAGGG -3'

Sequencing Primer
(F):5'- TCTGGACCACTCCTGAGAAG -3'
(R):5'- GGCCTCTGGAATATCAGGTCCATG -3'
Posted On2015-07-07