Incidental Mutation 'R4353:Dusp2'
ID327394
Institutional Source Beutler Lab
Gene Symbol Dusp2
Ensembl Gene ENSMUSG00000027368
Gene Namedual specificity phosphatase 2
SynonymsPAC1
MMRRC Submission 040866-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R4353 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location127336159-127338376 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127337336 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 204 (T204A)
Ref Sequence ENSEMBL: ENSMUSP00000028846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028846] [ENSMUST00000059839] [ENSMUST00000089673] [ENSMUST00000156747] [ENSMUST00000179618]
Predicted Effect probably damaging
Transcript: ENSMUST00000028846
AA Change: T204A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000028846
Gene: ENSMUSG00000027368
AA Change: T204A

DomainStartEndE-ValueType
RHOD 17 145 6.72e-10 SMART
DSPc 176 314 1.49e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059839
SMART Domains Protein: ENSMUSP00000054456
Gene: ENSMUSG00000050468

DomainStartEndE-ValueType
Blast:ZnMc 31 60 4e-8 BLAST
ZnMc 69 213 1.13e-39 SMART
low complexity region 292 308 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089673
SMART Domains Protein: ENSMUSP00000087102
Gene: ENSMUSG00000050468

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Blast:ZnMc 52 81 5e-8 BLAST
ZnMc 90 234 1.13e-39 SMART
low complexity region 313 329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146479
Predicted Effect probably benign
Transcript: ENSMUST00000156747
SMART Domains Protein: ENSMUSP00000116771
Gene: ENSMUSG00000050468

DomainStartEndE-ValueType
Blast:ZnMc 31 60 6e-9 BLAST
ZnMc 69 193 4.02e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179618
SMART Domains Protein: ENSMUSP00000135987
Gene: ENSMUSG00000050468

DomainStartEndE-ValueType
Blast:ZnMc 31 60 4e-8 BLAST
ZnMc 69 213 1.13e-39 SMART
low complexity region 292 308 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK1 and ERK2, is predominantly expressed in hematopoietic tissues, and is localized in the nucleus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced inflammatory responses in induced rheumatoid arthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T C 13: 105,118,745 Y445H probably benign Het
5730559C18Rik C T 1: 136,226,208 V180I probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpk2 C T 18: 65,291,452 R1888H possibly damaging Het
Arhgap33 C A 7: 30,524,136 V823L possibly damaging Het
Atp2b2 T C 6: 113,765,784 I736V probably benign Het
Atp8a1 T C 5: 67,769,108 T260A probably damaging Het
B4galnt3 T C 6: 120,215,476 E433G possibly damaging Het
Bzw2 A T 12: 36,123,979 F99I probably damaging Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Col27a1 G T 4: 63,225,631 A519S probably benign Het
Coq6 G A 12: 84,368,149 G110D probably damaging Het
Cpb1 T C 3: 20,262,544 T281A probably benign Het
Cttnbp2 T C 6: 18,514,704 D11G probably benign Het
Cyp2c37 A G 19: 40,000,545 Y316C possibly damaging Het
Dcdc2a T A 13: 25,056,491 I74N probably damaging Het
Dhx9 A G 1: 153,471,789 L391P probably damaging Het
Dsc2 G T 18: 20,050,068 L98I probably damaging Het
Dthd1 T A 5: 62,842,867 S511T probably benign Het
Elovl5 T C 9: 77,960,917 V37A probably benign Het
Etv1 A G 12: 38,857,106 E369G probably damaging Het
Gem G A 4: 11,705,939 R9H probably damaging Het
Heg1 A G 16: 33,710,477 T108A probably benign Het
Iqgap2 C T 13: 95,671,396 V788M probably damaging Het
Kyat3 T C 3: 142,731,293 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Meis2 A G 2: 116,059,563 M146T probably damaging Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Nup214 T C 2: 31,977,917 probably null Het
Olfr93 T A 17: 37,151,337 I58F probably damaging Het
Pabpc4 C T 4: 123,290,267 T191I probably damaging Het
Pcnx2 T C 8: 125,762,851 H1668R probably damaging Het
Poln C T 5: 34,129,452 C124Y probably benign Het
Ppp2r2a T A 14: 67,028,937 I92L probably damaging Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Rnf130 T C 11: 50,087,440 V276A possibly damaging Het
Rnf31 AAC A 14: 55,601,098 probably null Het
Rnf38 A T 4: 44,149,100 N82K possibly damaging Het
Scn7a T A 2: 66,676,436 M1370L probably benign Het
Sema4b C A 7: 80,215,651 L125I probably damaging Het
Slc12a7 C T 13: 73,790,734 T210I possibly damaging Het
Sox8 A C 17: 25,567,335 *465G probably null Het
Spg11 G T 2: 122,113,194 T159K possibly damaging Het
Stk36 A G 1: 74,632,807 R889G possibly damaging Het
Tmbim7 A G 5: 3,661,796 S14G probably benign Het
Usp16 A G 16: 87,470,354 N211D probably damaging Het
Vmn1r6 C T 6: 57,002,692 A113V possibly damaging Het
Zc3h14 A G 12: 98,763,960 N92D possibly damaging Het
Zfp638 T C 6: 83,984,059 S1206P probably damaging Het
Other mutations in Dusp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01545:Dusp2 APN 2 127337775 missense probably benign 0.00
R5973:Dusp2 UTSW 2 127337288 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTGGTCAGAAGGCCTAGAG -3'
(R):5'- AGGAATCAGGTGCCTGTACC -3'

Sequencing Primer
(F):5'- CAGAAGGCCTAGAGCTTCTCTTG -3'
(R):5'- GCCTGTACCTTCTCCCCTACAG -3'
Posted On2015-07-07