Incidental Mutation 'R4353:Cpb1'
ID327395
Institutional Source Beutler Lab
Gene Symbol Cpb1
Ensembl Gene ENSMUSG00000011463
Gene Namecarboxypeptidase B1 (tissue)
Synonyms1810063F02Rik, 0910001A18Rik, 2210008M23Rik
MMRRC Submission 040866-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4353 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location20248264-20275733 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20262544 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 281 (T281A)
Ref Sequence ENSEMBL: ENSMUSP00000011607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011607]
Predicted Effect probably benign
Transcript: ENSMUST00000011607
AA Change: T281A

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000011607
Gene: ENSMUSG00000011463
AA Change: T281A

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Propep_M14 26 102 2.4e-19 PFAM
Zn_pept 117 398 2.08e-147 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137855
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Three different procarboxypeptidases A and two different procarboxypeptidases B have been isolated. The B1 and B2 forms differ from each other mainly in isoelectric point. Carboxypeptidase B1 is a highly tissue-specific protein and is a useful serum marker for acute pancreatitis and dysfunction of pancreatic transplants. It is not elevated in pancreatic carcinoma. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T C 13: 105,118,745 Y445H probably benign Het
5730559C18Rik C T 1: 136,226,208 V180I probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpk2 C T 18: 65,291,452 R1888H possibly damaging Het
Arhgap33 C A 7: 30,524,136 V823L possibly damaging Het
Atp2b2 T C 6: 113,765,784 I736V probably benign Het
Atp8a1 T C 5: 67,769,108 T260A probably damaging Het
B4galnt3 T C 6: 120,215,476 E433G possibly damaging Het
Bzw2 A T 12: 36,123,979 F99I probably damaging Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Col27a1 G T 4: 63,225,631 A519S probably benign Het
Coq6 G A 12: 84,368,149 G110D probably damaging Het
Cttnbp2 T C 6: 18,514,704 D11G probably benign Het
Cyp2c37 A G 19: 40,000,545 Y316C possibly damaging Het
Dcdc2a T A 13: 25,056,491 I74N probably damaging Het
Dhx9 A G 1: 153,471,789 L391P probably damaging Het
Dsc2 G T 18: 20,050,068 L98I probably damaging Het
Dthd1 T A 5: 62,842,867 S511T probably benign Het
Dusp2 A G 2: 127,337,336 T204A probably damaging Het
Elovl5 T C 9: 77,960,917 V37A probably benign Het
Etv1 A G 12: 38,857,106 E369G probably damaging Het
Gem G A 4: 11,705,939 R9H probably damaging Het
Heg1 A G 16: 33,710,477 T108A probably benign Het
Iqgap2 C T 13: 95,671,396 V788M probably damaging Het
Kyat3 T C 3: 142,731,293 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Meis2 A G 2: 116,059,563 M146T probably damaging Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Nup214 T C 2: 31,977,917 probably null Het
Olfr93 T A 17: 37,151,337 I58F probably damaging Het
Pabpc4 C T 4: 123,290,267 T191I probably damaging Het
Pcnx2 T C 8: 125,762,851 H1668R probably damaging Het
Poln C T 5: 34,129,452 C124Y probably benign Het
Ppp2r2a T A 14: 67,028,937 I92L probably damaging Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Rnf130 T C 11: 50,087,440 V276A possibly damaging Het
Rnf31 AAC A 14: 55,601,098 probably null Het
Rnf38 A T 4: 44,149,100 N82K possibly damaging Het
Scn7a T A 2: 66,676,436 M1370L probably benign Het
Sema4b C A 7: 80,215,651 L125I probably damaging Het
Slc12a7 C T 13: 73,790,734 T210I possibly damaging Het
Sox8 A C 17: 25,567,335 *465G probably null Het
Spg11 G T 2: 122,113,194 T159K possibly damaging Het
Stk36 A G 1: 74,632,807 R889G possibly damaging Het
Tmbim7 A G 5: 3,661,796 S14G probably benign Het
Usp16 A G 16: 87,470,354 N211D probably damaging Het
Vmn1r6 C T 6: 57,002,692 A113V possibly damaging Het
Zc3h14 A G 12: 98,763,960 N92D possibly damaging Het
Zfp638 T C 6: 83,984,059 S1206P probably damaging Het
Other mutations in Cpb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Cpb1 APN 3 20252029 missense probably benign 0.00
IGL01061:Cpb1 APN 3 20266516 missense probably benign 0.06
IGL01376:Cpb1 APN 3 20270324 missense probably benign 0.00
IGL01409:Cpb1 APN 3 20249805 missense possibly damaging 0.51
IGL01505:Cpb1 APN 3 20266246 missense probably damaging 1.00
IGL01599:Cpb1 APN 3 20251954 critical splice donor site probably null
IGL01672:Cpb1 APN 3 20275421 missense probably null 0.34
IGL02421:Cpb1 APN 3 20251984 missense probably damaging 1.00
IGL02685:Cpb1 APN 3 20265356 missense probably damaging 1.00
IGL02825:Cpb1 APN 3 20249725 missense probably damaging 1.00
IGL02929:Cpb1 APN 3 20275466 missense probably benign 0.00
IGL03229:Cpb1 APN 3 20249837 nonsense probably null
R0106:Cpb1 UTSW 3 20266533 splice site probably null
R0106:Cpb1 UTSW 3 20266533 splice site probably null
R0485:Cpb1 UTSW 3 20275628 missense unknown
R0609:Cpb1 UTSW 3 20262474 missense probably damaging 1.00
R0622:Cpb1 UTSW 3 20249818 missense probably damaging 1.00
R0676:Cpb1 UTSW 3 20266533 splice site probably null
R0829:Cpb1 UTSW 3 20251943 splice site probably benign
R0981:Cpb1 UTSW 3 20275490 missense probably benign 0.29
R1496:Cpb1 UTSW 3 20263532 missense probably damaging 0.99
R1535:Cpb1 UTSW 3 20266287 missense probably benign 0.19
R1607:Cpb1 UTSW 3 20263782 missense probably benign 0.03
R1707:Cpb1 UTSW 3 20275491 missense probably damaging 0.99
R1753:Cpb1 UTSW 3 20266241 missense possibly damaging 0.67
R1866:Cpb1 UTSW 3 20263756 missense probably benign 0.00
R2177:Cpb1 UTSW 3 20266447 missense probably benign 0.41
R2234:Cpb1 UTSW 3 20275465 missense probably benign 0.04
R3110:Cpb1 UTSW 3 20265357 missense probably damaging 1.00
R3112:Cpb1 UTSW 3 20265357 missense probably damaging 1.00
R4405:Cpb1 UTSW 3 20263569 missense probably benign 0.00
R4485:Cpb1 UTSW 3 20249701 missense probably benign 0.00
R4734:Cpb1 UTSW 3 20263712 missense probably benign 0.43
R4984:Cpb1 UTSW 3 20270352 frame shift probably null
R5807:Cpb1 UTSW 3 20263742 missense probably damaging 0.98
R6377:Cpb1 UTSW 3 20275584 critical splice donor site probably null
R6441:Cpb1 UTSW 3 20249814 missense probably damaging 1.00
R7175:Cpb1 UTSW 3 20263763 missense probably benign 0.00
R7488:Cpb1 UTSW 3 20270324 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TTTCAACACTGAAGTGGTCTCTC -3'
(R):5'- GGGATACTACCTGCCTTCAC -3'

Sequencing Primer
(F):5'- ACTGAAGTGGTCTCTCTCGCATTG -3'
(R):5'- GATACTACCTGCCTTCACAAATATTG -3'
Posted On2015-07-07