Incidental Mutation 'R4353:Pabpc4'
ID327401
Institutional Source Beutler Lab
Gene Symbol Pabpc4
Ensembl Gene ENSMUSG00000011257
Gene Namepoly(A) binding protein, cytoplasmic 4
Synonyms
MMRRC Submission 040866-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4353 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location123262351-123298925 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 123290267 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 191 (T191I)
Ref Sequence ENSEMBL: ENSMUSP00000101850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078734] [ENSMUST00000080178] [ENSMUST00000106241] [ENSMUST00000106243] [ENSMUST00000183940]
Predicted Effect probably damaging
Transcript: ENSMUST00000078734
AA Change: T191I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077794
Gene: ENSMUSG00000011257
AA Change: T191I

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 171 2.91e-25 SMART
RRM 192 264 1.27e-25 SMART
RRM 295 366 2.54e-25 SMART
low complexity region 478 493 N/A INTRINSIC
low complexity region 503 516 N/A INTRINSIC
PolyA 534 597 4.49e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000080178
AA Change: T191I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079070
Gene: ENSMUSG00000011257
AA Change: T191I

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 171 2.91e-25 SMART
RRM 192 264 1.27e-25 SMART
RRM 295 366 2.54e-25 SMART
low complexity region 523 538 N/A INTRINSIC
low complexity region 548 561 N/A INTRINSIC
PolyA 579 642 4.49e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082721
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083844
Predicted Effect probably damaging
Transcript: ENSMUST00000106241
AA Change: T191I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101848
Gene: ENSMUSG00000011257
AA Change: T191I

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 171 2.91e-25 SMART
RRM 192 264 1.27e-25 SMART
RRM 295 366 2.54e-25 SMART
low complexity region 507 522 N/A INTRINSIC
low complexity region 532 545 N/A INTRINSIC
PolyA 563 626 4.49e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106243
AA Change: T191I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101850
Gene: ENSMUSG00000011257
AA Change: T191I

DomainStartEndE-ValueType
RRM 12 85 6.2e-24 SMART
RRM 100 171 1.2e-27 SMART
RRM 192 264 5.4e-28 SMART
RRM 295 366 1e-27 SMART
low complexity region 494 509 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
PolyA 550 613 2.1e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156807
Predicted Effect probably benign
Transcript: ENSMUST00000183940
SMART Domains Protein: ENSMUSP00000139135
Gene: ENSMUSG00000011257

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 167 7.64e-20 SMART
Meta Mutation Damage Score 0.3066 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Poly(A)-binding proteins (PABPs) bind to the poly(A) tail present at the 3-prime ends of most eukaryotic mRNAs. PABPC4 or IPABP (inducible PABP) was isolated as an activation-induced T-cell mRNA encoding a protein. Activation of T cells increased PABPC4 mRNA levels in T cells approximately 5-fold. PABPC4 contains 4 RNA-binding domains and proline-rich C terminus. PABPC4 is localized primarily to the cytoplasm. It is suggested that PABPC4 might be necessary for regulation of stability of labile mRNA species in activated T cells. PABPC4 was also identified as an antigen, APP1 (activated-platelet protein-1), expressed on thrombin-activated rabbit platelets. PABPC4 may also be involved in the regulation of protein translation in platelets and megakaryocytes or may participate in the binding or stabilization of polyadenylates in platelet dense granules. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T C 13: 105,118,745 Y445H probably benign Het
5730559C18Rik C T 1: 136,226,208 V180I probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpk2 C T 18: 65,291,452 R1888H possibly damaging Het
Arhgap33 C A 7: 30,524,136 V823L possibly damaging Het
Atp2b2 T C 6: 113,765,784 I736V probably benign Het
Atp8a1 T C 5: 67,769,108 T260A probably damaging Het
B4galnt3 T C 6: 120,215,476 E433G possibly damaging Het
Bzw2 A T 12: 36,123,979 F99I probably damaging Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Col27a1 G T 4: 63,225,631 A519S probably benign Het
Coq6 G A 12: 84,368,149 G110D probably damaging Het
Cpb1 T C 3: 20,262,544 T281A probably benign Het
Cttnbp2 T C 6: 18,514,704 D11G probably benign Het
Cyp2c37 A G 19: 40,000,545 Y316C possibly damaging Het
Dcdc2a T A 13: 25,056,491 I74N probably damaging Het
Dhx9 A G 1: 153,471,789 L391P probably damaging Het
Dsc2 G T 18: 20,050,068 L98I probably damaging Het
Dthd1 T A 5: 62,842,867 S511T probably benign Het
Dusp2 A G 2: 127,337,336 T204A probably damaging Het
Elovl5 T C 9: 77,960,917 V37A probably benign Het
Etv1 A G 12: 38,857,106 E369G probably damaging Het
Gem G A 4: 11,705,939 R9H probably damaging Het
Heg1 A G 16: 33,710,477 T108A probably benign Het
Iqgap2 C T 13: 95,671,396 V788M probably damaging Het
Kyat3 T C 3: 142,731,293 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Meis2 A G 2: 116,059,563 M146T probably damaging Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Nup214 T C 2: 31,977,917 probably null Het
Olfr93 T A 17: 37,151,337 I58F probably damaging Het
Pcnx2 T C 8: 125,762,851 H1668R probably damaging Het
Poln C T 5: 34,129,452 C124Y probably benign Het
Ppp2r2a T A 14: 67,028,937 I92L probably damaging Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Rnf130 T C 11: 50,087,440 V276A possibly damaging Het
Rnf31 AAC A 14: 55,601,098 probably null Het
Rnf38 A T 4: 44,149,100 N82K possibly damaging Het
Scn7a T A 2: 66,676,436 M1370L probably benign Het
Sema4b C A 7: 80,215,651 L125I probably damaging Het
Slc12a7 C T 13: 73,790,734 T210I possibly damaging Het
Sox8 A C 17: 25,567,335 *465G probably null Het
Spg11 G T 2: 122,113,194 T159K possibly damaging Het
Stk36 A G 1: 74,632,807 R889G possibly damaging Het
Tmbim7 A G 5: 3,661,796 S14G probably benign Het
Usp16 A G 16: 87,470,354 N211D probably damaging Het
Vmn1r6 C T 6: 57,002,692 A113V possibly damaging Het
Zc3h14 A G 12: 98,763,960 N92D possibly damaging Het
Zfp638 T C 6: 83,984,059 S1206P probably damaging Het
Other mutations in Pabpc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Pabpc4 APN 4 123286704 missense probably damaging 1.00
IGL00970:Pabpc4 APN 4 123286815 missense probably damaging 1.00
IGL03093:Pabpc4 APN 4 123286709 missense probably damaging 0.96
R0383:Pabpc4 UTSW 4 123297942 missense probably damaging 1.00
R0924:Pabpc4 UTSW 4 123294665 missense possibly damaging 0.56
R1076:Pabpc4 UTSW 4 123292908 missense possibly damaging 0.74
R1381:Pabpc4 UTSW 4 123289059 missense probably damaging 1.00
R1908:Pabpc4 UTSW 4 123289068 missense possibly damaging 0.68
R1957:Pabpc4 UTSW 4 123286865 missense probably damaging 1.00
R2324:Pabpc4 UTSW 4 123297778 splice site probably benign
R2567:Pabpc4 UTSW 4 123297951 missense probably damaging 1.00
R3768:Pabpc4 UTSW 4 123294612 missense probably damaging 1.00
R4350:Pabpc4 UTSW 4 123290267 missense probably damaging 1.00
R4352:Pabpc4 UTSW 4 123290267 missense probably damaging 1.00
R5304:Pabpc4 UTSW 4 123290307 missense probably benign 0.43
R5386:Pabpc4 UTSW 4 123294997 missense probably benign 0.15
R5622:Pabpc4 UTSW 4 123291731 critical splice acceptor site probably null
R6853:Pabpc4 UTSW 4 123294743 missense possibly damaging 0.60
R7558:Pabpc4 UTSW 4 123294620 missense possibly damaging 0.94
R7602:Pabpc4 UTSW 4 123292892 missense possibly damaging 0.59
R7631:Pabpc4 UTSW 4 123288970 missense probably damaging 0.96
R7714:Pabpc4 UTSW 4 123295309 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGTCCTCGTGCGTTTTAAC -3'
(R):5'- GGCCTGGACTCAATATCCAC -3'

Sequencing Primer
(F):5'- GTGCGTTTTAACCTCTCCTGTCAG -3'
(R):5'- AAGAGGGCGTCAGATCTCCTTAC -3'
Posted On2015-07-07