Incidental Mutation 'R4353:Tmbim7'
ID327402
Institutional Source Beutler Lab
Gene Symbol Tmbim7
Ensembl Gene ENSMUSG00000014529
Gene Nametransmembrane BAX inhibitor motif containing 7
SynonymsLgf5, 4930403J02Rik, Tmbim1b, 4930511M11Rik, 4930500J03Rik
MMRRC Submission 040866-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R4353 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location3651181-3680325 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3661796 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 14 (S14G)
Ref Sequence ENSEMBL: ENSMUSP00000014673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014673] [ENSMUST00000156117] [ENSMUST00000196304] [ENSMUST00000198739] [ENSMUST00000199959]
Predicted Effect probably benign
Transcript: ENSMUST00000014673
AA Change: S14G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000014673
Gene: ENSMUSG00000014529
AA Change: S14G

DomainStartEndE-ValueType
Pfam:Bax1-I 92 300 3.6e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115515
SMART Domains Protein: ENSMUSP00000111177
Gene: ENSMUSG00000014529

DomainStartEndE-ValueType
transmembrane domain 100 122 N/A INTRINSIC
transmembrane domain 143 162 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156117
SMART Domains Protein: ENSMUSP00000117435
Gene: ENSMUSG00000014529

DomainStartEndE-ValueType
Pfam:Bax1-I 55 205 2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196304
Predicted Effect probably benign
Transcript: ENSMUST00000198739
AA Change: S14G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143399
Gene: ENSMUSG00000014529
AA Change: S14G

DomainStartEndE-ValueType
Pfam:Bax1-I 28 222 3.2e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199959
SMART Domains Protein: ENSMUSP00000143241
Gene: ENSMUSG00000014529

DomainStartEndE-ValueType
Pfam:Bax1-I 1 96 2.6e-7 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T C 13: 105,118,745 Y445H probably benign Het
5730559C18Rik C T 1: 136,226,208 V180I probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpk2 C T 18: 65,291,452 R1888H possibly damaging Het
Arhgap33 C A 7: 30,524,136 V823L possibly damaging Het
Atp2b2 T C 6: 113,765,784 I736V probably benign Het
Atp8a1 T C 5: 67,769,108 T260A probably damaging Het
B4galnt3 T C 6: 120,215,476 E433G possibly damaging Het
Bzw2 A T 12: 36,123,979 F99I probably damaging Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Col27a1 G T 4: 63,225,631 A519S probably benign Het
Coq6 G A 12: 84,368,149 G110D probably damaging Het
Cpb1 T C 3: 20,262,544 T281A probably benign Het
Cttnbp2 T C 6: 18,514,704 D11G probably benign Het
Cyp2c37 A G 19: 40,000,545 Y316C possibly damaging Het
Dcdc2a T A 13: 25,056,491 I74N probably damaging Het
Dhx9 A G 1: 153,471,789 L391P probably damaging Het
Dsc2 G T 18: 20,050,068 L98I probably damaging Het
Dthd1 T A 5: 62,842,867 S511T probably benign Het
Dusp2 A G 2: 127,337,336 T204A probably damaging Het
Elovl5 T C 9: 77,960,917 V37A probably benign Het
Etv1 A G 12: 38,857,106 E369G probably damaging Het
Gem G A 4: 11,705,939 R9H probably damaging Het
Heg1 A G 16: 33,710,477 T108A probably benign Het
Iqgap2 C T 13: 95,671,396 V788M probably damaging Het
Kyat3 T C 3: 142,731,293 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Meis2 A G 2: 116,059,563 M146T probably damaging Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Nup214 T C 2: 31,977,917 probably null Het
Olfr93 T A 17: 37,151,337 I58F probably damaging Het
Pabpc4 C T 4: 123,290,267 T191I probably damaging Het
Pcnx2 T C 8: 125,762,851 H1668R probably damaging Het
Poln C T 5: 34,129,452 C124Y probably benign Het
Ppp2r2a T A 14: 67,028,937 I92L probably damaging Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Rnf130 T C 11: 50,087,440 V276A possibly damaging Het
Rnf31 AAC A 14: 55,601,098 probably null Het
Rnf38 A T 4: 44,149,100 N82K possibly damaging Het
Scn7a T A 2: 66,676,436 M1370L probably benign Het
Sema4b C A 7: 80,215,651 L125I probably damaging Het
Slc12a7 C T 13: 73,790,734 T210I possibly damaging Het
Sox8 A C 17: 25,567,335 *465G probably null Het
Spg11 G T 2: 122,113,194 T159K possibly damaging Het
Stk36 A G 1: 74,632,807 R889G possibly damaging Het
Usp16 A G 16: 87,470,354 N211D probably damaging Het
Vmn1r6 C T 6: 57,002,692 A113V possibly damaging Het
Zc3h14 A G 12: 98,763,960 N92D possibly damaging Het
Zfp638 T C 6: 83,984,059 S1206P probably damaging Het
Other mutations in Tmbim7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Tmbim7 APN 5 3679087 missense probably damaging 1.00
IGL01712:Tmbim7 APN 5 3670074 missense probably damaging 1.00
IGL03003:Tmbim7 APN 5 3661887 missense probably benign 0.39
IGL03115:Tmbim7 APN 5 3679158 makesense probably null
FR4340:Tmbim7 UTSW 5 3670064 missense possibly damaging 0.50
FR4342:Tmbim7 UTSW 5 3670064 missense possibly damaging 0.50
FR4589:Tmbim7 UTSW 5 3670064 missense possibly damaging 0.50
R0241:Tmbim7 UTSW 5 3666866 missense probably benign 0.15
R0241:Tmbim7 UTSW 5 3666866 missense probably benign 0.15
R1195:Tmbim7 UTSW 5 3661943 missense probably benign 0.00
R1195:Tmbim7 UTSW 5 3661943 missense probably benign 0.00
R1195:Tmbim7 UTSW 5 3661943 missense probably benign 0.00
R1462:Tmbim7 UTSW 5 3664304 missense probably damaging 1.00
R1462:Tmbim7 UTSW 5 3664304 missense probably damaging 1.00
R1590:Tmbim7 UTSW 5 3665338 splice site probably null
R1795:Tmbim7 UTSW 5 3657493 unclassified probably null
R2919:Tmbim7 UTSW 5 3673188 critical splice donor site probably null
R3896:Tmbim7 UTSW 5 3661916 missense probably benign 0.00
R4930:Tmbim7 UTSW 5 3661948 nonsense probably null
R5277:Tmbim7 UTSW 5 3673192 splice site probably null
R6475:Tmbim7 UTSW 5 3664319 missense probably benign 0.04
R6633:Tmbim7 UTSW 5 3657659 intron probably null
R6835:Tmbim7 UTSW 5 3661943 missense probably benign 0.11
R7047:Tmbim7 UTSW 5 3670112 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TGTCTTACAGGCGTTTGCTTAC -3'
(R):5'- TACAGTCTCATTTGAGGGAGTAAC -3'

Sequencing Primer
(F):5'- CAGGCGTTTGCTTACTCATTTAACAG -3'
(R):5'- CTCATTTGAGGGAGTAACATCCTCAG -3'
Posted On2015-07-07