Incidental Mutation 'R4353:Poln'
List |< first << previous [record 35 of 52] next >> last >|
ID327403
Institutional Source Beutler Lab
Gene Symbol Poln
Ensembl Gene ENSMUSG00000045102
Gene NameDNA polymerase N
SynonymsPOL4P
MMRRC Submission 040866-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4353 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location34007179-34169448 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34129452 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 124 (C124Y)
Ref Sequence ENSEMBL: ENSMUSP00000144578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042954] [ENSMUST00000202409] [ENSMUST00000202638]
Predicted Effect probably benign
Transcript: ENSMUST00000042954
AA Change: C124Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000036110
Gene: ENSMUSG00000045102
AA Change: C124Y

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
POLAc 605 814 7.88e-67 SMART
low complexity region 829 843 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202325
Predicted Effect probably benign
Transcript: ENSMUST00000202409
AA Change: C124Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144578
Gene: ENSMUSG00000045102
AA Change: C124Y

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
coiled coil region 448 471 N/A INTRINSIC
POLAc 587 796 2.6e-69 SMART
low complexity region 811 825 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202638
AA Change: C124Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143793
Gene: ENSMUSG00000045102
AA Change: C124Y

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
coiled coil region 448 471 N/A INTRINSIC
POLAc 605 770 3e-37 SMART
low complexity region 785 799 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced meiotic double-strand breaks at a meiotic recombination hot spot harboring insertion/deletion polymorphisms, but are otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T C 13: 105,118,745 Y445H probably benign Het
5730559C18Rik C T 1: 136,226,208 V180I probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpk2 C T 18: 65,291,452 R1888H possibly damaging Het
Arhgap33 C A 7: 30,524,136 V823L possibly damaging Het
Atp2b2 T C 6: 113,765,784 I736V probably benign Het
Atp8a1 T C 5: 67,769,108 T260A probably damaging Het
B4galnt3 T C 6: 120,215,476 E433G possibly damaging Het
Bzw2 A T 12: 36,123,979 F99I probably damaging Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Col27a1 G T 4: 63,225,631 A519S probably benign Het
Coq6 G A 12: 84,368,149 G110D probably damaging Het
Cpb1 T C 3: 20,262,544 T281A probably benign Het
Cttnbp2 T C 6: 18,514,704 D11G probably benign Het
Cyp2c37 A G 19: 40,000,545 Y316C possibly damaging Het
Dcdc2a T A 13: 25,056,491 I74N probably damaging Het
Dhx9 A G 1: 153,471,789 L391P probably damaging Het
Dsc2 G T 18: 20,050,068 L98I probably damaging Het
Dthd1 T A 5: 62,842,867 S511T probably benign Het
Dusp2 A G 2: 127,337,336 T204A probably damaging Het
Elovl5 T C 9: 77,960,917 V37A probably benign Het
Etv1 A G 12: 38,857,106 E369G probably damaging Het
Gem G A 4: 11,705,939 R9H probably damaging Het
Heg1 A G 16: 33,710,477 T108A probably benign Het
Iqgap2 C T 13: 95,671,396 V788M probably damaging Het
Kyat3 T C 3: 142,731,293 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Meis2 A G 2: 116,059,563 M146T probably damaging Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Nup214 T C 2: 31,977,917 probably null Het
Olfr93 T A 17: 37,151,337 I58F probably damaging Het
Pabpc4 C T 4: 123,290,267 T191I probably damaging Het
Pcnx2 T C 8: 125,762,851 H1668R probably damaging Het
Ppp2r2a T A 14: 67,028,937 I92L probably damaging Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Rnf130 T C 11: 50,087,440 V276A possibly damaging Het
Rnf31 AAC A 14: 55,601,098 probably null Het
Rnf38 A T 4: 44,149,100 N82K possibly damaging Het
Scn7a T A 2: 66,676,436 M1370L probably benign Het
Sema4b C A 7: 80,215,651 L125I probably damaging Het
Slc12a7 C T 13: 73,790,734 T210I possibly damaging Het
Sox8 A C 17: 25,567,335 *465G probably null Het
Spg11 G T 2: 122,113,194 T159K possibly damaging Het
Stk36 A G 1: 74,632,807 R889G possibly damaging Het
Tmbim7 A G 5: 3,661,796 S14G probably benign Het
Usp16 A G 16: 87,470,354 N211D probably damaging Het
Vmn1r6 C T 6: 57,002,692 A113V possibly damaging Het
Zc3h14 A G 12: 98,763,960 N92D possibly damaging Het
Zfp638 T C 6: 83,984,059 S1206P probably damaging Het
Other mutations in Poln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00803:Poln APN 5 34122760 missense probably benign 0.17
IGL00938:Poln APN 5 34129224 missense probably damaging 1.00
IGL02081:Poln APN 5 34129139 missense probably benign
IGL02411:Poln APN 5 34113322 nonsense probably null
IGL02440:Poln APN 5 34129130 missense probably damaging 1.00
IGL02484:Poln APN 5 34129377 missense probably damaging 1.00
IGL02577:Poln APN 5 34113335 missense probably benign 0.03
IGL03113:Poln APN 5 34116862 missense probably benign 0.01
R0034:Poln UTSW 5 34115418 missense possibly damaging 0.78
R0034:Poln UTSW 5 34115418 missense possibly damaging 0.78
R0068:Poln UTSW 5 34077088 splice site probably benign
R0068:Poln UTSW 5 34077088 splice site probably benign
R0325:Poln UTSW 5 34149764 missense probably benign 0.00
R0578:Poln UTSW 5 34014338 missense probably damaging 1.00
R0631:Poln UTSW 5 34118958 missense possibly damaging 0.93
R1171:Poln UTSW 5 34103940 missense probably damaging 1.00
R1266:Poln UTSW 5 34133109 critical splice donor site probably null
R1418:Poln UTSW 5 34078975 missense probably benign 0.00
R1449:Poln UTSW 5 34014338 missense probably damaging 1.00
R1558:Poln UTSW 5 34032799 missense probably benign 0.04
R1723:Poln UTSW 5 34122672 missense probably benign 0.16
R1806:Poln UTSW 5 34107150 splice site probably benign
R4124:Poln UTSW 5 34103951 missense probably benign 0.32
R4125:Poln UTSW 5 34103951 missense probably benign 0.32
R4128:Poln UTSW 5 34103951 missense probably benign 0.32
R4155:Poln UTSW 5 34009649 missense possibly damaging 0.90
R4717:Poln UTSW 5 34129448 missense possibly damaging 0.46
R4788:Poln UTSW 5 34129331 missense probably benign 0.30
R4981:Poln UTSW 5 34107085 critical splice donor site probably null
R5456:Poln UTSW 5 34007442 missense possibly damaging 0.95
R6020:Poln UTSW 5 34109431 missense probably damaging 0.99
R6484:Poln UTSW 5 34129513 missense probably benign 0.01
R7134:Poln UTSW 5 34118996 missense possibly damaging 0.86
R7639:Poln UTSW 5 34133151 missense possibly damaging 0.77
R7764:Poln UTSW 5 34116807 critical splice donor site probably null
R7874:Poln UTSW 5 34024350 missense probably damaging 1.00
R7957:Poln UTSW 5 34024350 missense probably damaging 1.00
R8039:Poln UTSW 5 34122672 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GGAGTTTGGCCAGGATTCAG -3'
(R):5'- GGTTTCTACACATGTCTCATGAATC -3'

Sequencing Primer
(F):5'- AGTCCCATCAGTATCTTTTTCCAGAG -3'
(R):5'- AGGATCCATTGAGCTCTG -3'
Posted On2015-07-07