Incidental Mutation 'R0045:Cds2'
ID32741
Institutional Source Beutler Lab
Gene Symbol Cds2
Ensembl Gene ENSMUSG00000058793
Gene NameCDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2
Synonyms5730460C18Rik, 5730450N06Rik, D2Wsu127e
MMRRC Submission 038339-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0045 (G1)
Quality Score86
Status Validated
Chromosome2
Chromosomal Location132263148-132312050 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 132305155 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 402 (G402V)
Ref Sequence ENSEMBL: ENSMUSP00000099470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089461] [ENSMUST00000103181]
Predicted Effect probably benign
Transcript: ENSMUST00000089461
AA Change: G385V

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000086886
Gene: ENSMUSG00000058793
AA Change: G385V

DomainStartEndE-ValueType
Pfam:CTP_transf_1 52 382 5e-90 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000103181
AA Change: G402V

PolyPhen 2 Score 0.674 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099470
Gene: ENSMUSG00000058793
AA Change: G402V

DomainStartEndE-ValueType
Pfam:CTP_transf_1 69 399 7.6e-90 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000138194
AA Change: G151V
SMART Domains Protein: ENSMUSP00000121769
Gene: ENSMUSG00000058793
AA Change: G151V

DomainStartEndE-ValueType
Pfam:CTP_transf_1 3 126 8.7e-34 PFAM
Meta Mutation Damage Score 0.0982 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Breakdown products of phosphoinositides are ubiquitous second messengers that function downstream of many G protein-coupled receptors and tyrosine kinases regulating cell growth, calcium metabolism, and protein kinase C activity. This gene encodes an enzyme which regulates the amount of phosphatidylinositol available for signaling by catalyzing the conversion of phosphatidic acid to CDP-diacylglycerol. This enzyme is an integral membrane protein localized to two subcellular domains, the matrix side of the inner mitochondrial membrane where it is thought to be involved in the synthesis of phosphatidylglycerol and cardiolipin and the cytoplasmic side of the endoplasmic reticulum where it functions in phosphatidylinositol biosynthesis. Two genes encoding this enzyme have been identified in humans, one mapping to human chromosome 4q21 and a second to 20p13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a lethal phenotype. Heterozygotes show a distorted lymphocyte distribution and enhanced sensorimotor gating. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,082,085 N299S probably damaging Het
Abi3 A G 11: 95,832,715 *368R probably null Het
Agbl1 T C 7: 76,698,840 probably null Het
Ap3b2 T C 7: 81,466,193 D650G possibly damaging Het
Arhgap30 A G 1: 171,408,430 S791G probably benign Het
Arvcf T A 16: 18,403,458 L722Q probably benign Het
Ascc3 C T 10: 50,718,402 R1198* probably null Het
Atf2 G T 2: 73,829,856 T189N probably benign Het
Atf7ip A G 6: 136,559,816 K16E probably damaging Het
Atg9b G T 5: 24,387,398 Q621K probably damaging Het
Atp12a G A 14: 56,372,873 E234K probably damaging Het
C8a T C 4: 104,826,815 K368E probably benign Het
Cdh23 T C 10: 60,530,978 Y241C probably damaging Het
Cdon G A 9: 35,486,807 S940N probably benign Het
Cog6 T C 3: 52,992,750 probably null Het
Commd10 T C 18: 46,967,836 S114P possibly damaging Het
Dram2 T C 3: 106,570,817 V155A possibly damaging Het
Egr2 T A 10: 67,540,480 V252E probably benign Het
Exoc3l C T 8: 105,293,685 V203M probably damaging Het
Fsip1 C A 2: 118,248,292 probably null Het
Gm10840 C A 11: 106,161,100 probably benign Het
Gm8251 T C 1: 44,057,205 K1578E probably benign Het
Gpr37l1 A G 1: 135,161,145 L394P probably damaging Het
Gsap T C 5: 21,226,832 M243T possibly damaging Het
Hsd3b5 T A 3: 98,619,144 I329F probably benign Het
Htra1 T A 7: 130,961,532 S164R probably damaging Het
Il17b G A 18: 61,690,244 V50M probably damaging Het
Itga4 A T 2: 79,301,031 Y581F probably damaging Het
Jmjd8 A G 17: 25,829,281 E92G probably damaging Het
Kcnq4 T A 4: 120,697,955 D677V probably damaging Het
Klhl42 A G 6: 147,092,168 T213A probably benign Het
Lcn5 T C 2: 25,660,698 S133P probably damaging Het
Liph T C 16: 21,968,053 Y271C probably damaging Het
Lpcat3 T C 6: 124,701,474 I228T probably benign Het
Lrrd1 A G 5: 3,866,418 K812E possibly damaging Het
Ltbp2 G A 12: 84,809,587 T701I probably damaging Het
Ltbp2 T C 12: 84,813,288 T631A probably damaging Het
Mavs G A 2: 131,238,831 R13Q probably damaging Het
Mtor C G 4: 148,464,949 H597D probably benign Het
Muc5b T A 7: 141,856,818 H1309Q unknown Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Nnat A T 2: 157,560,488 probably benign Het
Olfr183 G A 16: 59,000,491 D269N probably benign Het
Olfr293 T C 7: 86,664,340 L226S possibly damaging Het
Olfr703 T A 7: 106,845,389 Y259* probably null Het
Olfr869 A T 9: 20,137,191 Q25L probably benign Het
Pclo C T 5: 14,539,471 A595V unknown Het
Pcsk6 T A 7: 65,962,928 C315S probably damaging Het
Pkd2 T A 5: 104,455,805 probably benign Het
Ppp2r3c T A 12: 55,293,821 I155F probably damaging Het
Rapgef4 A G 2: 72,198,778 H398R possibly damaging Het
Ripor2 A G 13: 24,694,226 D328G probably damaging Het
Rpgrip1 A T 14: 52,141,144 T509S possibly damaging Het
Sh3pxd2a A G 19: 47,267,183 I1032T probably damaging Het
Slc25a13 A T 6: 6,109,277 S362T probably benign Het
Stk35 A T 2: 129,800,568 R10* probably null Het
Tal1 A G 4: 115,068,565 D277G probably damaging Het
Tecta G A 9: 42,375,191 T723I probably damaging Het
Trp53bp1 A C 2: 121,204,497 V103G probably benign Het
Trpv4 A G 5: 114,636,457 S189P probably benign Het
Ttll5 T G 12: 85,879,359 probably benign Het
Usp8 A G 2: 126,742,223 T451A probably benign Het
Vac14 G A 8: 110,636,952 D340N probably benign Het
Vars C A 17: 34,998,066 A471S probably benign Het
Vars A T 17: 35,010,619 H404L probably damaging Het
Vmn2r70 T C 7: 85,566,044 N94S probably damaging Het
Vpreb2 T C 16: 17,980,767 L39P probably damaging Het
Vps13a A T 19: 16,640,810 L693* probably null Het
Wapl A G 14: 34,733,794 I176V probably benign Het
Wdr31 G T 4: 62,464,033 L4I possibly damaging Het
Other mutations in Cds2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cds2 APN 2 132297293 missense probably damaging 1.00
IGL00434:Cds2 APN 2 132293351 missense probably damaging 0.99
IGL00771:Cds2 APN 2 132304352 splice site probably benign
IGL00984:Cds2 APN 2 132298521 missense probably benign 0.02
IGL02041:Cds2 APN 2 132294443 missense possibly damaging 0.94
sugarless UTSW 2 132298483 missense probably damaging 1.00
R0045:Cds2 UTSW 2 132305155 missense possibly damaging 0.67
R0452:Cds2 UTSW 2 132298479 missense probably damaging 0.99
R0455:Cds2 UTSW 2 132285967 critical splice donor site probably null
R0593:Cds2 UTSW 2 132297376 unclassified probably benign
R0831:Cds2 UTSW 2 132285967 critical splice donor site probably null
R1053:Cds2 UTSW 2 132305260 missense probably damaging 1.00
R1669:Cds2 UTSW 2 132295519 splice site probably null
R1740:Cds2 UTSW 2 132302213 missense possibly damaging 0.63
R1859:Cds2 UTSW 2 132302195 missense probably damaging 1.00
R4125:Cds2 UTSW 2 132297271 missense probably benign 0.00
R4126:Cds2 UTSW 2 132297271 missense probably benign 0.00
R4128:Cds2 UTSW 2 132297271 missense probably benign 0.00
R4352:Cds2 UTSW 2 132263445 start codon destroyed probably null 0.37
R4467:Cds2 UTSW 2 132294446 nonsense probably null
R4698:Cds2 UTSW 2 132304953 missense probably damaging 0.97
R4704:Cds2 UTSW 2 132300602 nonsense probably null
R4917:Cds2 UTSW 2 132298478 missense probably damaging 0.98
R5070:Cds2 UTSW 2 132302088 nonsense probably null
R5199:Cds2 UTSW 2 132298483 missense probably damaging 1.00
R5431:Cds2 UTSW 2 132302170 missense probably benign 0.28
R5704:Cds2 UTSW 2 132293329 missense probably benign 0.01
R5858:Cds2 UTSW 2 132302113 missense probably benign 0.00
R5946:Cds2 UTSW 2 132297248 missense probably damaging 1.00
R5954:Cds2 UTSW 2 132297271 missense probably benign 0.00
R7195:Cds2 UTSW 2 132293284 missense probably benign 0.28
R7234:Cds2 UTSW 2 132304480 critical splice donor site probably null
R7413:Cds2 UTSW 2 132293315 missense probably benign 0.03
R7983:Cds2 UTSW 2 132263510 splice site probably null
Predicted Primers PCR Primer
(F):5'- CGCTTTGACTGCCAGTACCTGATG -3'
(R):5'- CAATGTATGATCTCTCGCACAGCCC -3'

Sequencing Primer
(F):5'- AGCTTTATCAGGTGCGGAACTAC -3'
(R):5'- CAGAAACCCAAATGGTTCTTTCCTG -3'
Posted On2013-05-09