Incidental Mutation 'R4353:B4galnt3'
List |< first << previous [record 8 of 52] next >> last >|
ID327410
Institutional Source Beutler Lab
Gene Symbol B4galnt3
Ensembl Gene ENSMUSG00000041372
Gene Namebeta-1,4-N-acetyl-galactosaminyl transferase 3
Synonyms
MMRRC Submission 040866-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R4353 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location120203073-120294559 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120215476 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 433 (E433G)
Ref Sequence ENSEMBL: ENSMUSP00000058253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057283] [ENSMUST00000212457]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057283
AA Change: E433G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000058253
Gene: ENSMUSG00000041372
AA Change: E433G

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
PA14 129 276 1.16e-21 SMART
low complexity region 591 612 N/A INTRINSIC
Pfam:CHGN 650 985 3.9e-29 PFAM
Pfam:Glyco_transf_7C 896 974 3.3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125341
Predicted Effect possibly damaging
Transcript: ENSMUST00000212457
AA Change: E432G

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] B4GALNT3 transfers N-acetylgalactosamine (GalNAc) onto glucosyl residues to form N,N-prime-diacetyllactosediamine (LacdiNAc, or LDN), a unique terminal structure of cell surface N-glycans (Ikehara et al., 2006 [PubMed 16728562]).[supplied by OMIM, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T C 13: 105,118,745 Y445H probably benign Het
5730559C18Rik C T 1: 136,226,208 V180I probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpk2 C T 18: 65,291,452 R1888H possibly damaging Het
Arhgap33 C A 7: 30,524,136 V823L possibly damaging Het
Atp2b2 T C 6: 113,765,784 I736V probably benign Het
Atp8a1 T C 5: 67,769,108 T260A probably damaging Het
Bzw2 A T 12: 36,123,979 F99I probably damaging Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Col27a1 G T 4: 63,225,631 A519S probably benign Het
Coq6 G A 12: 84,368,149 G110D probably damaging Het
Cpb1 T C 3: 20,262,544 T281A probably benign Het
Cttnbp2 T C 6: 18,514,704 D11G probably benign Het
Cyp2c37 A G 19: 40,000,545 Y316C possibly damaging Het
Dcdc2a T A 13: 25,056,491 I74N probably damaging Het
Dhx9 A G 1: 153,471,789 L391P probably damaging Het
Dsc2 G T 18: 20,050,068 L98I probably damaging Het
Dthd1 T A 5: 62,842,867 S511T probably benign Het
Dusp2 A G 2: 127,337,336 T204A probably damaging Het
Elovl5 T C 9: 77,960,917 V37A probably benign Het
Etv1 A G 12: 38,857,106 E369G probably damaging Het
Gem G A 4: 11,705,939 R9H probably damaging Het
Heg1 A G 16: 33,710,477 T108A probably benign Het
Iqgap2 C T 13: 95,671,396 V788M probably damaging Het
Kyat3 T C 3: 142,731,293 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Meis2 A G 2: 116,059,563 M146T probably damaging Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Nup214 T C 2: 31,977,917 probably null Het
Olfr93 T A 17: 37,151,337 I58F probably damaging Het
Pabpc4 C T 4: 123,290,267 T191I probably damaging Het
Pcnx2 T C 8: 125,762,851 H1668R probably damaging Het
Poln C T 5: 34,129,452 C124Y probably benign Het
Ppp2r2a T A 14: 67,028,937 I92L probably damaging Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Rnf130 T C 11: 50,087,440 V276A possibly damaging Het
Rnf31 AAC A 14: 55,601,098 probably null Het
Rnf38 A T 4: 44,149,100 N82K possibly damaging Het
Scn7a T A 2: 66,676,436 M1370L probably benign Het
Sema4b C A 7: 80,215,651 L125I probably damaging Het
Slc12a7 C T 13: 73,790,734 T210I possibly damaging Het
Sox8 A C 17: 25,567,335 *465G probably null Het
Spg11 G T 2: 122,113,194 T159K possibly damaging Het
Stk36 A G 1: 74,632,807 R889G possibly damaging Het
Tmbim7 A G 5: 3,661,796 S14G probably benign Het
Usp16 A G 16: 87,470,354 N211D probably damaging Het
Vmn1r6 C T 6: 57,002,692 A113V possibly damaging Het
Zc3h14 A G 12: 98,763,960 N92D possibly damaging Het
Zfp638 T C 6: 83,984,059 S1206P probably damaging Het
Other mutations in B4galnt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:B4galnt3 APN 6 120215390 missense possibly damaging 0.87
IGL01543:B4galnt3 APN 6 120209312 missense probably benign 0.00
IGL02692:B4galnt3 APN 6 120210311 missense probably damaging 1.00
IGL03149:B4galnt3 APN 6 120231594 splice site probably benign
IGL03272:B4galnt3 APN 6 120216306 missense probably damaging 1.00
Minimus UTSW 6 120215057 missense probably benign
R0121:B4galnt3 UTSW 6 120215038 missense probably benign
R0414:B4galnt3 UTSW 6 120216565 missense probably benign 0.05
R1885:B4galnt3 UTSW 6 120223640 missense probably damaging 0.99
R1908:B4galnt3 UTSW 6 120210090 critical splice donor site probably null
R2264:B4galnt3 UTSW 6 120203810 makesense probably null
R4208:B4galnt3 UTSW 6 120215102 missense probably damaging 0.99
R4649:B4galnt3 UTSW 6 120224620 missense probably damaging 1.00
R4874:B4galnt3 UTSW 6 120207206 missense probably damaging 1.00
R5046:B4galnt3 UTSW 6 120214798 missense probably damaging 1.00
R5232:B4galnt3 UTSW 6 120232988 missense probably damaging 1.00
R5431:B4galnt3 UTSW 6 120218967 missense probably damaging 1.00
R5447:B4galnt3 UTSW 6 120215057 missense probably benign
R5458:B4galnt3 UTSW 6 120210385 missense probably damaging 0.98
R5793:B4galnt3 UTSW 6 120208904 critical splice donor site probably null
R5954:B4galnt3 UTSW 6 120225188 missense possibly damaging 0.88
R5985:B4galnt3 UTSW 6 120210158 missense probably damaging 1.00
R6156:B4galnt3 UTSW 6 120214840 missense probably benign 0.02
R6176:B4galnt3 UTSW 6 120224164 missense probably damaging 1.00
R6207:B4galnt3 UTSW 6 120206614 splice site probably null
R6565:B4galnt3 UTSW 6 120217479 nonsense probably null
R7153:B4galnt3 UTSW 6 120214968 missense probably benign 0.00
R7268:B4galnt3 UTSW 6 120215042 missense possibly damaging 0.92
R7307:B4galnt3 UTSW 6 120215431 missense probably benign 0.00
R7311:B4galnt3 UTSW 6 120215435 nonsense probably null
R7360:B4galnt3 UTSW 6 120232979 nonsense probably null
R7538:B4galnt3 UTSW 6 120294423 nonsense probably null
R7674:B4galnt3 UTSW 6 120215205 missense probably benign 0.01
R7706:B4galnt3 UTSW 6 120218952 missense probably benign 0.16
R7727:B4galnt3 UTSW 6 120225187 missense probably benign 0.03
X0028:B4galnt3 UTSW 6 120231552 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCTGGATGAGAGGCAGGTTC -3'
(R):5'- GGTAACTGAGGTAGGATAGCTTATC -3'

Sequencing Primer
(F):5'- AGACAAATCTCGGCTGGGCAC -3'
(R):5'- GATAGCTTATCCAGGTCACCC -3'
Posted On2015-07-07