Incidental Mutation 'R4353:Prpmp5'
ID327412
Institutional Source Beutler Lab
Gene Symbol Prpmp5
Ensembl Gene ENSMUSG00000107874
Gene Nameproline-rich protein MP5
SynonymsMP5
MMRRC Submission 040866-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R4353 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location132311590-132314757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 132313661 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 25 (Y25S)
Ref Sequence ENSEMBL: ENSMUSP00000047347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048686]
Predicted Effect unknown
Transcript: ENSMUST00000048686
AA Change: Y25S
SMART Domains Protein: ENSMUSP00000047347
Gene: ENSMUSG00000107874
AA Change: Y25S

DomainStartEndE-ValueType
Pfam:Pro-rich 1 136 2.2e-36 PFAM
Pfam:Pro-rich 84 169 6.1e-17 PFAM
Pfam:Pro-rich 131 182 2.5e-10 PFAM
Pfam:Pro-rich 171 228 4.7e-10 PFAM
Pfam:Pro-rich 222 290 1.1e-11 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T C 13: 105,118,745 Y445H probably benign Het
5730559C18Rik C T 1: 136,226,208 V180I probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpk2 C T 18: 65,291,452 R1888H possibly damaging Het
Arhgap33 C A 7: 30,524,136 V823L possibly damaging Het
Atp2b2 T C 6: 113,765,784 I736V probably benign Het
Atp8a1 T C 5: 67,769,108 T260A probably damaging Het
B4galnt3 T C 6: 120,215,476 E433G possibly damaging Het
Bzw2 A T 12: 36,123,979 F99I probably damaging Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Col27a1 G T 4: 63,225,631 A519S probably benign Het
Coq6 G A 12: 84,368,149 G110D probably damaging Het
Cpb1 T C 3: 20,262,544 T281A probably benign Het
Cttnbp2 T C 6: 18,514,704 D11G probably benign Het
Cyp2c37 A G 19: 40,000,545 Y316C possibly damaging Het
Dcdc2a T A 13: 25,056,491 I74N probably damaging Het
Dhx9 A G 1: 153,471,789 L391P probably damaging Het
Dsc2 G T 18: 20,050,068 L98I probably damaging Het
Dthd1 T A 5: 62,842,867 S511T probably benign Het
Dusp2 A G 2: 127,337,336 T204A probably damaging Het
Elovl5 T C 9: 77,960,917 V37A probably benign Het
Etv1 A G 12: 38,857,106 E369G probably damaging Het
Gem G A 4: 11,705,939 R9H probably damaging Het
Heg1 A G 16: 33,710,477 T108A probably benign Het
Iqgap2 C T 13: 95,671,396 V788M probably damaging Het
Kyat3 T C 3: 142,731,293 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Meis2 A G 2: 116,059,563 M146T probably damaging Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Nup214 T C 2: 31,977,917 probably null Het
Olfr93 T A 17: 37,151,337 I58F probably damaging Het
Pabpc4 C T 4: 123,290,267 T191I probably damaging Het
Pcnx2 T C 8: 125,762,851 H1668R probably damaging Het
Poln C T 5: 34,129,452 C124Y probably benign Het
Ppp2r2a T A 14: 67,028,937 I92L probably damaging Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Rnf130 T C 11: 50,087,440 V276A possibly damaging Het
Rnf31 AAC A 14: 55,601,098 probably null Het
Rnf38 A T 4: 44,149,100 N82K possibly damaging Het
Scn7a T A 2: 66,676,436 M1370L probably benign Het
Sema4b C A 7: 80,215,651 L125I probably damaging Het
Slc12a7 C T 13: 73,790,734 T210I possibly damaging Het
Sox8 A C 17: 25,567,335 *465G probably null Het
Spg11 G T 2: 122,113,194 T159K possibly damaging Het
Stk36 A G 1: 74,632,807 R889G possibly damaging Het
Tmbim7 A G 5: 3,661,796 S14G probably benign Het
Usp16 A G 16: 87,470,354 N211D probably damaging Het
Vmn1r6 C T 6: 57,002,692 A113V possibly damaging Het
Zc3h14 A G 12: 98,763,960 N92D possibly damaging Het
Zfp638 T C 6: 83,984,059 S1206P probably damaging Het
Other mutations in Prpmp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Prpmp5 APN 6 132312420 missense unknown
IGL02259:Prpmp5 APN 6 132312674 missense unknown
IGL02434:Prpmp5 APN 6 132312376 missense unknown
IGL03238:Prpmp5 APN 6 132312345 missense unknown
R0971:Prpmp5 UTSW 6 132313655 missense unknown
R1900:Prpmp5 UTSW 6 132314698 missense unknown
R3800:Prpmp5 UTSW 6 132312694 missense unknown
R3951:Prpmp5 UTSW 6 132312694 missense unknown
R3952:Prpmp5 UTSW 6 132312694 missense unknown
R3981:Prpmp5 UTSW 6 132312694 missense unknown
R4083:Prpmp5 UTSW 6 132312694 missense unknown
R4348:Prpmp5 UTSW 6 132313661 missense unknown
R4351:Prpmp5 UTSW 6 132313661 missense unknown
R4352:Prpmp5 UTSW 6 132313661 missense unknown
R6190:Prpmp5 UTSW 6 132312729 missense unknown
R7001:Prpmp5 UTSW 6 132312564 missense unknown
Predicted Primers PCR Primer
(F):5'- GCCTAGCTTCGAGTTCTTCCAG -3'
(R):5'- CATGTCTCCCTGAAGTTGTGG -3'

Sequencing Primer
(F):5'- GCCCTGCTGTAAAGTCAATG -3'
(R):5'- CATGTCTCCCTGAAGTTGTGGTAATG -3'
Posted On2015-07-07