Incidental Mutation 'R4353:Elovl5'
ID327419
Institutional Source Beutler Lab
Gene Symbol Elovl5
Ensembl Gene ENSMUSG00000032349
Gene NameELOVL family member 5, elongation of long chain fatty acids (yeast)
Synonyms1110059L23Rik
MMRRC Submission 040866-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4353 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location77917364-77984519 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77960917 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 37 (V37A)
Ref Sequence ENSEMBL: ENSMUSP00000120171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034904] [ENSMUST00000133757] [ENSMUST00000134072]
Predicted Effect probably benign
Transcript: ENSMUST00000034904
AA Change: V37A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034904
Gene: ENSMUSG00000032349
AA Change: V37A

DomainStartEndE-ValueType
Pfam:ELO 27 262 2.3e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133757
AA Change: V37A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123121
Gene: ENSMUSG00000032349
AA Change: V37A

DomainStartEndE-ValueType
Pfam:ELO 27 180 4.6e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134072
AA Change: V37A

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000120171
Gene: ENSMUSG00000032349
AA Change: V37A

DomainStartEndE-ValueType
Pfam:ELO 27 70 3.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148398
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ELO family. It is highly expressed in the adrenal gland and testis, and encodes a multi-pass membrane protein that is localized in the endoplasmic reticulum. This protein is involved in the elongation of long-chain polyunsaturated fatty acids. Mutations in this gene have been associated with spinocerebellar ataxia-38 (SCA38). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a gene trapped allele have defects in fatty acid synthesis in the liver that result in hepatic steatosis. Also, majority of female mice have defects in female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T C 13: 105,118,745 Y445H probably benign Het
5730559C18Rik C T 1: 136,226,208 V180I probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpk2 C T 18: 65,291,452 R1888H possibly damaging Het
Arhgap33 C A 7: 30,524,136 V823L possibly damaging Het
Atp2b2 T C 6: 113,765,784 I736V probably benign Het
Atp8a1 T C 5: 67,769,108 T260A probably damaging Het
B4galnt3 T C 6: 120,215,476 E433G possibly damaging Het
Bzw2 A T 12: 36,123,979 F99I probably damaging Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Col27a1 G T 4: 63,225,631 A519S probably benign Het
Coq6 G A 12: 84,368,149 G110D probably damaging Het
Cpb1 T C 3: 20,262,544 T281A probably benign Het
Cttnbp2 T C 6: 18,514,704 D11G probably benign Het
Cyp2c37 A G 19: 40,000,545 Y316C possibly damaging Het
Dcdc2a T A 13: 25,056,491 I74N probably damaging Het
Dhx9 A G 1: 153,471,789 L391P probably damaging Het
Dsc2 G T 18: 20,050,068 L98I probably damaging Het
Dthd1 T A 5: 62,842,867 S511T probably benign Het
Dusp2 A G 2: 127,337,336 T204A probably damaging Het
Etv1 A G 12: 38,857,106 E369G probably damaging Het
Gem G A 4: 11,705,939 R9H probably damaging Het
Heg1 A G 16: 33,710,477 T108A probably benign Het
Iqgap2 C T 13: 95,671,396 V788M probably damaging Het
Kyat3 T C 3: 142,731,293 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Meis2 A G 2: 116,059,563 M146T probably damaging Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Nup214 T C 2: 31,977,917 probably null Het
Olfr93 T A 17: 37,151,337 I58F probably damaging Het
Pabpc4 C T 4: 123,290,267 T191I probably damaging Het
Pcnx2 T C 8: 125,762,851 H1668R probably damaging Het
Poln C T 5: 34,129,452 C124Y probably benign Het
Ppp2r2a T A 14: 67,028,937 I92L probably damaging Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Rnf130 T C 11: 50,087,440 V276A possibly damaging Het
Rnf31 AAC A 14: 55,601,098 probably null Het
Rnf38 A T 4: 44,149,100 N82K possibly damaging Het
Scn7a T A 2: 66,676,436 M1370L probably benign Het
Sema4b C A 7: 80,215,651 L125I probably damaging Het
Slc12a7 C T 13: 73,790,734 T210I possibly damaging Het
Sox8 A C 17: 25,567,335 *465G probably null Het
Spg11 G T 2: 122,113,194 T159K possibly damaging Het
Stk36 A G 1: 74,632,807 R889G possibly damaging Het
Tmbim7 A G 5: 3,661,796 S14G probably benign Het
Usp16 A G 16: 87,470,354 N211D probably damaging Het
Vmn1r6 C T 6: 57,002,692 A113V possibly damaging Het
Zc3h14 A G 12: 98,763,960 N92D possibly damaging Het
Zfp638 T C 6: 83,984,059 S1206P probably damaging Het
Other mutations in Elovl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Elovl5 APN 9 77960974 missense probably benign 0.12
IGL01017:Elovl5 APN 9 77981571 missense possibly damaging 0.67
IGL02331:Elovl5 APN 9 77979899 missense possibly damaging 0.81
IGL02851:Elovl5 APN 9 77981502 missense probably damaging 1.00
IGL03011:Elovl5 APN 9 77982784 missense probably benign 0.32
laid-up UTSW 9 77981502 missense probably damaging 0.99
R0452:Elovl5 UTSW 9 77960911 missense probably damaging 1.00
R0494:Elovl5 UTSW 9 77960917 missense probably benign 0.05
R3706:Elovl5 UTSW 9 77979837 missense probably null 1.00
R6211:Elovl5 UTSW 9 77981502 missense probably damaging 0.99
R6640:Elovl5 UTSW 9 77979913 nonsense probably null
R7804:Elovl5 UTSW 9 77979823 critical splice acceptor site probably null
RF031:Elovl5 UTSW 9 77981473 critical splice acceptor site probably null
Z1176:Elovl5 UTSW 9 77976755 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- ACCTGTATCAAAAGAGCTTTGC -3'
(R):5'- ACAGATGCCTTTCTTCACGTAGG -3'

Sequencing Primer
(F):5'- TCAAAAGAGCTTTGCTTTATTTGATG -3'
(R):5'- TTCTTCACGTAGGGACACAC -3'
Posted On2015-07-07