Incidental Mutation 'R4353:Rnf130'
ID327421
Institutional Source Beutler Lab
Gene Symbol Rnf130
Ensembl Gene ENSMUSG00000020376
Gene Namering finger protein 130
SynonymsG1RZFP, G1RP, 2510042A13Rik
MMRRC Submission 040866-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R4353 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location50025346-50104758 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50087440 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 276 (V276A)
Ref Sequence ENSEMBL: ENSMUSP00000056345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054684] [ENSMUST00000102776]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054684
AA Change: V276A

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000056345
Gene: ENSMUSG00000020376
AA Change: V276A

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
Pfam:PA 65 169 4.6e-13 PFAM
transmembrane domain 195 217 N/A INTRINSIC
RING 264 304 5.51e-7 SMART
low complexity region 341 354 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102776
AA Change: V276A

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099837
Gene: ENSMUSG00000020376
AA Change: V276A

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
Pfam:PA 69 167 8.1e-14 PFAM
transmembrane domain 195 217 N/A INTRINSIC
RING 264 304 5.51e-7 SMART
low complexity region 341 354 N/A INTRINSIC
transmembrane domain 387 409 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger motif and is similar to g1, a Drosophila zinc-finger protein that is expressed in mesoderm and involved in embryonic development. The expression of the mouse counterpart was found to be upregulated in myeloblastic cells following IL3 deprivation, suggesting that this gene may regulate growth factor withdrawal-induced apoptosis of myeloid precursor cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T C 13: 105,118,745 Y445H probably benign Het
5730559C18Rik C T 1: 136,226,208 V180I probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpk2 C T 18: 65,291,452 R1888H possibly damaging Het
Arhgap33 C A 7: 30,524,136 V823L possibly damaging Het
Atp2b2 T C 6: 113,765,784 I736V probably benign Het
Atp8a1 T C 5: 67,769,108 T260A probably damaging Het
B4galnt3 T C 6: 120,215,476 E433G possibly damaging Het
Bzw2 A T 12: 36,123,979 F99I probably damaging Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Col27a1 G T 4: 63,225,631 A519S probably benign Het
Coq6 G A 12: 84,368,149 G110D probably damaging Het
Cpb1 T C 3: 20,262,544 T281A probably benign Het
Cttnbp2 T C 6: 18,514,704 D11G probably benign Het
Cyp2c37 A G 19: 40,000,545 Y316C possibly damaging Het
Dcdc2a T A 13: 25,056,491 I74N probably damaging Het
Dhx9 A G 1: 153,471,789 L391P probably damaging Het
Dsc2 G T 18: 20,050,068 L98I probably damaging Het
Dthd1 T A 5: 62,842,867 S511T probably benign Het
Dusp2 A G 2: 127,337,336 T204A probably damaging Het
Elovl5 T C 9: 77,960,917 V37A probably benign Het
Etv1 A G 12: 38,857,106 E369G probably damaging Het
Gem G A 4: 11,705,939 R9H probably damaging Het
Heg1 A G 16: 33,710,477 T108A probably benign Het
Iqgap2 C T 13: 95,671,396 V788M probably damaging Het
Kyat3 T C 3: 142,731,293 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Meis2 A G 2: 116,059,563 M146T probably damaging Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Nup214 T C 2: 31,977,917 probably null Het
Olfr93 T A 17: 37,151,337 I58F probably damaging Het
Pabpc4 C T 4: 123,290,267 T191I probably damaging Het
Pcnx2 T C 8: 125,762,851 H1668R probably damaging Het
Poln C T 5: 34,129,452 C124Y probably benign Het
Ppp2r2a T A 14: 67,028,937 I92L probably damaging Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Rnf31 AAC A 14: 55,601,098 probably null Het
Rnf38 A T 4: 44,149,100 N82K possibly damaging Het
Scn7a T A 2: 66,676,436 M1370L probably benign Het
Sema4b C A 7: 80,215,651 L125I probably damaging Het
Slc12a7 C T 13: 73,790,734 T210I possibly damaging Het
Sox8 A C 17: 25,567,335 *465G probably null Het
Spg11 G T 2: 122,113,194 T159K possibly damaging Het
Stk36 A G 1: 74,632,807 R889G possibly damaging Het
Tmbim7 A G 5: 3,661,796 S14G probably benign Het
Usp16 A G 16: 87,470,354 N211D probably damaging Het
Vmn1r6 C T 6: 57,002,692 A113V possibly damaging Het
Zc3h14 A G 12: 98,763,960 N92D possibly damaging Het
Zfp638 T C 6: 83,984,059 S1206P probably damaging Het
Other mutations in Rnf130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Rnf130 APN 11 50093796 missense probably damaging 1.00
IGL02364:Rnf130 APN 11 50095840 missense probably benign
IGL02948:Rnf130 APN 11 50052771 splice site probably benign
R0145:Rnf130 UTSW 11 50071219 missense possibly damaging 0.89
R0358:Rnf130 UTSW 11 50071282 missense probably benign 0.01
R0570:Rnf130 UTSW 11 50095876 missense possibly damaging 0.66
R0786:Rnf130 UTSW 11 50087437 missense probably damaging 1.00
R1709:Rnf130 UTSW 11 50087386 missense possibly damaging 0.80
R2312:Rnf130 UTSW 11 50087463 critical splice donor site probably null
R2972:Rnf130 UTSW 11 50093800 nonsense probably null
R4398:Rnf130 UTSW 11 50071378 missense probably benign 0.08
R5162:Rnf130 UTSW 11 50052895 missense probably damaging 1.00
R5236:Rnf130 UTSW 11 50095978 missense probably damaging 0.99
R5869:Rnf130 UTSW 11 50085815 splice site probably null
R6432:Rnf130 UTSW 11 50095790 nonsense probably null
R6865:Rnf130 UTSW 11 50071264 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCCGGCTTAATGTAAGACAC -3'
(R):5'- AGAGGAATTCTGGTCAGAGTTG -3'

Sequencing Primer
(F):5'- TGGCTCATATGTAATTTGGATCAAC -3'
(R):5'- GTCAGAGTTGACCAAGACCTTC -3'
Posted On2015-07-07