Incidental Mutation 'R4353:Etv1'
ID327424
Institutional Source Beutler Lab
Gene Symbol Etv1
Ensembl Gene ENSMUSG00000004151
Gene Nameets variant 1
SynonymsEtsrp81, ER81
MMRRC Submission 040866-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.657) question?
Stock #R4353 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location38779380-38870484 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38857106 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 369 (E369G)
Ref Sequence ENSEMBL: ENSMUSP00000125157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095767] [ENSMUST00000159334] [ENSMUST00000160244] [ENSMUST00000160701] [ENSMUST00000160856] [ENSMUST00000161980] [ENSMUST00000162563]
Predicted Effect probably damaging
Transcript: ENSMUST00000095767
AA Change: E369G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093442
Gene: ENSMUSG00000004151
AA Change: E369G

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 1 333 5e-153 PFAM
ETS 334 419 1.72e-57 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159334
AA Change: E329G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125676
Gene: ENSMUSG00000004151
AA Change: E329G

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 16 293 1.1e-112 PFAM
ETS 294 379 1.72e-57 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160244
AA Change: E346G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125733
Gene: ENSMUSG00000004151
AA Change: E346G

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 1 310 2.5e-133 PFAM
ETS 311 396 1.72e-57 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160701
AA Change: E266G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124019
Gene: ENSMUSG00000004151
AA Change: E266G

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 14 82 1.4e-30 PFAM
Pfam:ETS_PEA3_N 80 230 1.6e-68 PFAM
ETS 231 316 1.72e-57 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160856
AA Change: E351G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125692
Gene: ENSMUSG00000004151
AA Change: E351G

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 1 315 3.8e-130 PFAM
ETS 316 401 1.72e-57 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161591
Predicted Effect probably damaging
Transcript: ENSMUST00000161980
AA Change: E311G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124736
Gene: ENSMUSG00000004151
AA Change: E311G

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 10 275 3.2e-104 PFAM
ETS 276 361 1.72e-57 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162563
AA Change: E369G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125157
Gene: ENSMUSG00000004151
AA Change: E369G

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 1 333 5.6e-150 PFAM
ETS 334 419 1.72e-57 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162730
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ETS (E twenty-six) family of transcription factors. The ETS proteins regulate many target genes that modulate biological processes like cell growth, angiogenesis, migration, proliferation and differentiation. All ETS proteins contain an ETS DNA-binding domain that binds to DNA sequences containing the consensus 5'-CGGA[AT]-3'. The protein encoded by this gene contains a conserved short acidic transactivation domain (TAD) in the N-terminal region, in addition to the ETS DNA-binding domain in the C-terminal region. This gene is involved in chromosomal translocations, which result in multiple fusion proteins including EWS-ETV1 in Ewing sarcoma and at least 10 ETV1 partners (see PMID: 19657377, Table 1) in prostate cancer. In addition to chromosomal rearrangement, this gene is overexpressed in prostate cancer, melanoma and gastrointestinal stromal tumor. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous inactivation of this gene leads to premature death, ataxia, impaired limb coordination, defects in muscle innervation, muscle spindle differentiation and sensory-motor connectivity, deficient golgi tendon organs, and absence of Pacinian corpuscles and their afferents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T C 13: 105,118,745 Y445H probably benign Het
5730559C18Rik C T 1: 136,226,208 V180I probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpk2 C T 18: 65,291,452 R1888H possibly damaging Het
Arhgap33 C A 7: 30,524,136 V823L possibly damaging Het
Atp2b2 T C 6: 113,765,784 I736V probably benign Het
Atp8a1 T C 5: 67,769,108 T260A probably damaging Het
B4galnt3 T C 6: 120,215,476 E433G possibly damaging Het
Bzw2 A T 12: 36,123,979 F99I probably damaging Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Col27a1 G T 4: 63,225,631 A519S probably benign Het
Coq6 G A 12: 84,368,149 G110D probably damaging Het
Cpb1 T C 3: 20,262,544 T281A probably benign Het
Cttnbp2 T C 6: 18,514,704 D11G probably benign Het
Cyp2c37 A G 19: 40,000,545 Y316C possibly damaging Het
Dcdc2a T A 13: 25,056,491 I74N probably damaging Het
Dhx9 A G 1: 153,471,789 L391P probably damaging Het
Dsc2 G T 18: 20,050,068 L98I probably damaging Het
Dthd1 T A 5: 62,842,867 S511T probably benign Het
Dusp2 A G 2: 127,337,336 T204A probably damaging Het
Elovl5 T C 9: 77,960,917 V37A probably benign Het
Gem G A 4: 11,705,939 R9H probably damaging Het
Heg1 A G 16: 33,710,477 T108A probably benign Het
Iqgap2 C T 13: 95,671,396 V788M probably damaging Het
Kyat3 T C 3: 142,731,293 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Meis2 A G 2: 116,059,563 M146T probably damaging Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Nup214 T C 2: 31,977,917 probably null Het
Olfr93 T A 17: 37,151,337 I58F probably damaging Het
Pabpc4 C T 4: 123,290,267 T191I probably damaging Het
Pcnx2 T C 8: 125,762,851 H1668R probably damaging Het
Poln C T 5: 34,129,452 C124Y probably benign Het
Ppp2r2a T A 14: 67,028,937 I92L probably damaging Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Rnf130 T C 11: 50,087,440 V276A possibly damaging Het
Rnf31 AAC A 14: 55,601,098 probably null Het
Rnf38 A T 4: 44,149,100 N82K possibly damaging Het
Scn7a T A 2: 66,676,436 M1370L probably benign Het
Sema4b C A 7: 80,215,651 L125I probably damaging Het
Slc12a7 C T 13: 73,790,734 T210I possibly damaging Het
Sox8 A C 17: 25,567,335 *465G probably null Het
Spg11 G T 2: 122,113,194 T159K possibly damaging Het
Stk36 A G 1: 74,632,807 R889G possibly damaging Het
Tmbim7 A G 5: 3,661,796 S14G probably benign Het
Usp16 A G 16: 87,470,354 N211D probably damaging Het
Vmn1r6 C T 6: 57,002,692 A113V possibly damaging Het
Zc3h14 A G 12: 98,763,960 N92D possibly damaging Het
Zfp638 T C 6: 83,984,059 S1206P probably damaging Het
Other mutations in Etv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Etv1 APN 12 38781792 splice site probably benign
IGL01376:Etv1 APN 12 38857040 missense probably damaging 1.00
IGL01387:Etv1 APN 12 38861327 missense probably damaging 0.99
IGL01936:Etv1 APN 12 38835061 splice site probably benign
IGL02388:Etv1 APN 12 38781799 missense possibly damaging 0.62
IGL02933:Etv1 APN 12 38781833 missense probably benign 0.22
R0844:Etv1 UTSW 12 38861354 missense probably damaging 1.00
R0993:Etv1 UTSW 12 38827864 missense probably damaging 1.00
R1187:Etv1 UTSW 12 38865564 missense probably damaging 1.00
R1710:Etv1 UTSW 12 38852262 missense probably benign 0.18
R2094:Etv1 UTSW 12 38835116 missense probably null 1.00
R2879:Etv1 UTSW 12 38783810 splice site probably null
R3607:Etv1 UTSW 12 38831086 missense probably damaging 1.00
R4646:Etv1 UTSW 12 38865686 missense possibly damaging 0.94
R4678:Etv1 UTSW 12 38835220 missense probably damaging 1.00
R4768:Etv1 UTSW 12 38827793 missense probably damaging 1.00
R4812:Etv1 UTSW 12 38861288 missense probably damaging 1.00
R4877:Etv1 UTSW 12 38831293 unclassified probably null
R5024:Etv1 UTSW 12 38854234 splice site probably null
R5253:Etv1 UTSW 12 38852249 missense possibly damaging 0.50
R5936:Etv1 UTSW 12 38835210 missense probably damaging 1.00
R6085:Etv1 UTSW 12 38854195 missense probably damaging 1.00
R6167:Etv1 UTSW 12 38865641 missense possibly damaging 0.88
R6709:Etv1 UTSW 12 38783797 missense possibly damaging 0.93
R7046:Etv1 UTSW 12 38784370 intron probably null
R7243:Etv1 UTSW 12 38857046 missense probably benign 0.36
R7616:Etv1 UTSW 12 38865606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGACGGCATAATCGTGC -3'
(R):5'- TCTTTATAGTCACATGGGGCTC -3'

Sequencing Primer
(F):5'- CAGACGGCATAATCGTGCTTATAATC -3'
(R):5'- AGTCACATGGGGCTCTAAATATC -3'
Posted On2015-07-07