Incidental Mutation 'R4353:Dsc2'
ID327437
Institutional Source Beutler Lab
Gene Symbol Dsc2
Ensembl Gene ENSMUSG00000024331
Gene Namedesmocollin 2
SynonymsDsc2b, Dsc2a
MMRRC Submission 040866-MU
Accession Numbers

Genbank: NM_013505; MGI: 103221

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4353 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location20030633-20059554 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 20050068 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 98 (L98I)
Ref Sequence ENSEMBL: ENSMUSP00000074702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]
Predicted Effect probably damaging
Transcript: ENSMUST00000039247
AA Change: L98I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: L98I

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075214
AA Change: L98I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: L98I

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Pfam:Cadherin_C 730 901 3.7e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000128464
AA Change: L98I

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331
AA Change: L98I

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T C 13: 105,118,745 Y445H probably benign Het
5730559C18Rik C T 1: 136,226,208 V180I probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpk2 C T 18: 65,291,452 R1888H possibly damaging Het
Arhgap33 C A 7: 30,524,136 V823L possibly damaging Het
Atp2b2 T C 6: 113,765,784 I736V probably benign Het
Atp8a1 T C 5: 67,769,108 T260A probably damaging Het
B4galnt3 T C 6: 120,215,476 E433G possibly damaging Het
Bzw2 A T 12: 36,123,979 F99I probably damaging Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Col27a1 G T 4: 63,225,631 A519S probably benign Het
Coq6 G A 12: 84,368,149 G110D probably damaging Het
Cpb1 T C 3: 20,262,544 T281A probably benign Het
Cttnbp2 T C 6: 18,514,704 D11G probably benign Het
Cyp2c37 A G 19: 40,000,545 Y316C possibly damaging Het
Dcdc2a T A 13: 25,056,491 I74N probably damaging Het
Dhx9 A G 1: 153,471,789 L391P probably damaging Het
Dthd1 T A 5: 62,842,867 S511T probably benign Het
Dusp2 A G 2: 127,337,336 T204A probably damaging Het
Elovl5 T C 9: 77,960,917 V37A probably benign Het
Etv1 A G 12: 38,857,106 E369G probably damaging Het
Gem G A 4: 11,705,939 R9H probably damaging Het
Heg1 A G 16: 33,710,477 T108A probably benign Het
Iqgap2 C T 13: 95,671,396 V788M probably damaging Het
Kyat3 T C 3: 142,731,293 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Meis2 A G 2: 116,059,563 M146T probably damaging Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Nup214 T C 2: 31,977,917 probably null Het
Olfr93 T A 17: 37,151,337 I58F probably damaging Het
Pabpc4 C T 4: 123,290,267 T191I probably damaging Het
Pcnx2 T C 8: 125,762,851 H1668R probably damaging Het
Poln C T 5: 34,129,452 C124Y probably benign Het
Ppp2r2a T A 14: 67,028,937 I92L probably damaging Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Rnf130 T C 11: 50,087,440 V276A possibly damaging Het
Rnf31 AAC A 14: 55,601,098 probably null Het
Rnf38 A T 4: 44,149,100 N82K possibly damaging Het
Scn7a T A 2: 66,676,436 M1370L probably benign Het
Sema4b C A 7: 80,215,651 L125I probably damaging Het
Slc12a7 C T 13: 73,790,734 T210I possibly damaging Het
Sox8 A C 17: 25,567,335 *465G probably null Het
Spg11 G T 2: 122,113,194 T159K possibly damaging Het
Stk36 A G 1: 74,632,807 R889G possibly damaging Het
Tmbim7 A G 5: 3,661,796 S14G probably benign Het
Usp16 A G 16: 87,470,354 N211D probably damaging Het
Vmn1r6 C T 6: 57,002,692 A113V possibly damaging Het
Zc3h14 A G 12: 98,763,960 N92D possibly damaging Het
Zfp638 T C 6: 83,984,059 S1206P probably damaging Het
Other mutations in Dsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Dsc2 APN 18 20041797 missense probably benign 0.01
IGL00826:Dsc2 APN 18 20035315 missense probably damaging 1.00
IGL00852:Dsc2 APN 18 20034683 missense probably benign 0.01
IGL01082:Dsc2 APN 18 20043792 missense probably damaging 1.00
IGL01328:Dsc2 APN 18 20048286 missense probably damaging 0.98
IGL01338:Dsc2 APN 18 20047157 missense probably benign 0.19
IGL01727:Dsc2 APN 18 20038200 missense probably benign 0.01
IGL01766:Dsc2 APN 18 20046342 missense possibly damaging 0.56
IGL02228:Dsc2 APN 18 20043733 missense probably damaging 0.99
IGL02560:Dsc2 APN 18 20045539 missense probably damaging 1.00
IGL02794:Dsc2 APN 18 20041731 missense probably damaging 1.00
3-1:Dsc2 UTSW 18 20047079 missense possibly damaging 0.60
PIT4305001:Dsc2 UTSW 18 20046243 missense probably damaging 0.96
PIT4431001:Dsc2 UTSW 18 20046277 nonsense probably null
R0288:Dsc2 UTSW 18 20033120 missense probably damaging 1.00
R0542:Dsc2 UTSW 18 20051226 missense probably damaging 0.99
R0562:Dsc2 UTSW 18 20041537 missense probably damaging 0.99
R0697:Dsc2 UTSW 18 20041452 missense probably damaging 0.99
R0940:Dsc2 UTSW 18 20050059 missense probably damaging 0.97
R1081:Dsc2 UTSW 18 20033295 missense probably damaging 0.96
R1140:Dsc2 UTSW 18 20032212 missense probably damaging 1.00
R1515:Dsc2 UTSW 18 20034701 missense probably damaging 0.99
R1515:Dsc2 UTSW 18 20045565 missense probably benign 0.40
R1558:Dsc2 UTSW 18 20050151 missense probably damaging 0.99
R1654:Dsc2 UTSW 18 20046246 missense probably benign 0.01
R2061:Dsc2 UTSW 18 20032399 missense possibly damaging 0.79
R2089:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2172:Dsc2 UTSW 18 20045502 missense probably damaging 1.00
R2247:Dsc2 UTSW 18 20035312 missense probably damaging 1.00
R2472:Dsc2 UTSW 18 20045469 missense probably benign 0.00
R2927:Dsc2 UTSW 18 20045501 missense probably damaging 1.00
R3611:Dsc2 UTSW 18 20032351 missense probably damaging 0.99
R3961:Dsc2 UTSW 18 20051227 missense probably damaging 0.98
R3963:Dsc2 UTSW 18 20051227 missense probably damaging 0.98
R4362:Dsc2 UTSW 18 20050157 missense probably damaging 1.00
R4612:Dsc2 UTSW 18 20041819 missense probably damaging 1.00
R4613:Dsc2 UTSW 18 20041819 missense probably damaging 1.00
R4752:Dsc2 UTSW 18 20038222 missense probably damaging 1.00
R4946:Dsc2 UTSW 18 20050157 missense probably damaging 1.00
R5056:Dsc2 UTSW 18 20050142 missense probably damaging 1.00
R5267:Dsc2 UTSW 18 20034583 critical splice donor site probably null
R5445:Dsc2 UTSW 18 20035303 missense possibly damaging 0.76
R5507:Dsc2 UTSW 18 20046279 missense probably damaging 0.96
R5575:Dsc2 UTSW 18 20035390 missense probably damaging 1.00
R5781:Dsc2 UTSW 18 20032510 missense probably benign 0.00
R6102:Dsc2 UTSW 18 20047108 missense probably benign 0.01
R6129:Dsc2 UTSW 18 20045430 missense possibly damaging 0.95
R6362:Dsc2 UTSW 18 20035463 nonsense probably null
R6433:Dsc2 UTSW 18 20051175 critical splice donor site probably null
R6513:Dsc2 UTSW 18 20046238 missense probably benign
R6615:Dsc2 UTSW 18 20032519 missense possibly damaging 0.88
R6619:Dsc2 UTSW 18 20032278 missense probably benign 0.22
R6665:Dsc2 UTSW 18 20050148 missense probably damaging 1.00
R6961:Dsc2 UTSW 18 20038222 missense probably damaging 1.00
R7179:Dsc2 UTSW 18 20035275 critical splice donor site probably null
R7275:Dsc2 UTSW 18 20051179 nonsense probably null
R7352:Dsc2 UTSW 18 20035335 missense probably benign 0.39
R7386:Dsc2 UTSW 18 20041926 missense possibly damaging 0.84
R7496:Dsc2 UTSW 18 20035394 nonsense probably null
R7510:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R7580:Dsc2 UTSW 18 20050073 missense probably damaging 1.00
R7718:Dsc2 UTSW 18 20041778 missense probably damaging 0.98
R7733:Dsc2 UTSW 18 20048315 missense probably benign 0.00
R7733:Dsc2 UTSW 18 20048316 missense probably benign 0.16
R7818:Dsc2 UTSW 18 20050132 missense probably damaging 1.00
R7852:Dsc2 UTSW 18 20046285 missense possibly damaging 0.67
R7998:Dsc2 UTSW 18 20034663 missense possibly damaging 0.87
R8029:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8030:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8031:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8032:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8059:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8060:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8061:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8062:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8063:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8082:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8090:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8114:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8115:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8116:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8117:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8118:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8328:Dsc2 UTSW 18 20032519 missense possibly damaging 0.68
Z1088:Dsc2 UTSW 18 20046304 missense probably damaging 0.98
Z1176:Dsc2 UTSW 18 20035299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACATGTTTCCCAACCAAGC -3'
(R):5'- TGTGGCTACATTGACTGCTATG -3'

Sequencing Primer
(F):5'- TCTCTAAAGCACCATTGACCCTGG -3'
(R):5'- GCTATGTATATTTTCTGCAGTGAACC -3'
Posted On2015-07-07