Incidental Mutation 'R4354:Susd2'
ID327453
Institutional Source Beutler Lab
Gene Symbol Susd2
Ensembl Gene ENSMUSG00000006342
Gene Namesushi domain containing 2
Synonyms1200011D11Rik
MMRRC Submission 041107-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R4354 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location75636706-75644008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 75639728 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 447 (F447L)
Ref Sequence ENSEMBL: ENSMUSP00000093197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077610] [ENSMUST00000095541]
Predicted Effect probably damaging
Transcript: ENSMUST00000077610
AA Change: F327L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076802
Gene: ENSMUSG00000006342
AA Change: F327L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
AMOP 162 310 4.09e-82 SMART
VWD 313 489 1.9e-19 SMART
CCP 602 655 3.37e-17 SMART
transmembrane domain 663 685 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095541
AA Change: F447L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093197
Gene: ENSMUSG00000006342
AA Change: F447L

DomainStartEndE-ValueType
SO 25 64 4.77e-2 SMART
AMOP 282 430 4.09e-82 SMART
VWD 433 609 1.9e-19 SMART
CCP 722 775 3.37e-17 SMART
transmembrane domain 783 805 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219733
Meta Mutation Damage Score 0.2975 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
Abca8b A C 11: 109,971,692 S416A probably benign Het
Abcb4 A T 5: 8,918,771 N370I probably benign Het
Abi3bp T C 16: 56,532,951 F81S probably benign Het
Ablim1 C T 19: 57,155,278 C83Y probably damaging Het
Adamtsl1 A T 4: 86,156,684 H96L probably damaging Het
Alms1-ps1 C T 6: 85,755,635 noncoding transcript Het
AU040320 A G 4: 126,854,399 probably benign Het
Chd1 T A 17: 17,390,001 H472Q probably benign Het
Chgb A T 2: 132,793,944 D602V probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gpa33 A G 1: 166,163,835 T212A possibly damaging Het
Hspg2 C A 4: 137,468,911 A17E probably benign Het
Irf7 T C 7: 141,265,270 R8G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Loxhd1 T C 18: 77,395,427 Y1235H probably damaging Het
Mon2 T C 10: 123,026,983 T680A probably benign Het
Nab1 A T 1: 52,490,696 L14Q probably damaging Het
Neu4 C T 1: 94,024,557 T216I probably damaging Het
Nle1 A G 11: 82,906,431 C152R possibly damaging Het
Nprl3 T A 11: 32,234,906 M368L probably benign Het
Nudt9 A G 5: 104,058,111 K129E probably damaging Het
Olfr368 T C 2: 37,331,876 L43P probably damaging Het
Pdzd8 T C 19: 59,345,481 D36G probably benign Het
Pga5 C T 19: 10,674,826 probably null Het
Pold3 T C 7: 100,100,617 K47E possibly damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rab3gap1 A G 1: 127,915,641 I251V probably benign Het
Tbc1d7 T C 13: 43,169,868 K16E probably damaging Het
Tlr8 T G X: 167,242,872 Q994P probably damaging Het
Ube2j1 T C 4: 33,049,682 Y227H probably benign Het
Other mutations in Susd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Susd2 APN 10 75638048 missense probably benign 0.02
IGL00907:Susd2 APN 10 75640931 missense probably benign 0.04
IGL01155:Susd2 APN 10 75640892 missense possibly damaging 0.87
IGL01677:Susd2 APN 10 75639431 missense possibly damaging 0.91
IGL02146:Susd2 APN 10 75638433 missense possibly damaging 0.79
IGL02273:Susd2 APN 10 75640938 missense possibly damaging 0.94
IGL02386:Susd2 APN 10 75640095 missense probably damaging 0.97
IGL02475:Susd2 APN 10 75637499 critical splice donor site probably null
IGL03218:Susd2 APN 10 75642625 missense probably benign
PIT4418001:Susd2 UTSW 10 75638349 missense probably benign 0.24
R0135:Susd2 UTSW 10 75638514 missense probably damaging 1.00
R0396:Susd2 UTSW 10 75639911 missense probably damaging 1.00
R0401:Susd2 UTSW 10 75638603 splice site probably benign
R0608:Susd2 UTSW 10 75638235 missense probably benign 0.45
R0636:Susd2 UTSW 10 75639350 missense probably damaging 1.00
R1470:Susd2 UTSW 10 75638054 missense probably damaging 1.00
R1470:Susd2 UTSW 10 75638054 missense probably damaging 1.00
R1619:Susd2 UTSW 10 75638044 missense possibly damaging 0.66
R1634:Susd2 UTSW 10 75637555 missense probably benign 0.04
R1866:Susd2 UTSW 10 75639732 missense probably damaging 0.98
R4451:Susd2 UTSW 10 75639398 missense probably damaging 1.00
R4721:Susd2 UTSW 10 75638130 missense probably benign 0.00
R5546:Susd2 UTSW 10 75642218 missense probably benign 0.01
R5768:Susd2 UTSW 10 75638019 missense probably damaging 0.98
R5769:Susd2 UTSW 10 75638019 missense probably damaging 0.98
R5770:Susd2 UTSW 10 75638019 missense probably damaging 0.98
R5771:Susd2 UTSW 10 75638019 missense probably damaging 0.98
R5960:Susd2 UTSW 10 75639936 missense probably damaging 1.00
R6152:Susd2 UTSW 10 75638019 missense probably damaging 0.98
R6153:Susd2 UTSW 10 75638019 missense probably damaging 0.98
R6259:Susd2 UTSW 10 75638046 missense probably damaging 1.00
R6291:Susd2 UTSW 10 75637574 missense possibly damaging 0.61
R7106:Susd2 UTSW 10 75638053 missense probably damaging 1.00
R7232:Susd2 UTSW 10 75639851 missense probably damaging 1.00
R7297:Susd2 UTSW 10 75642568 missense probably benign 0.19
R7326:Susd2 UTSW 10 75642565 missense probably benign 0.00
X0025:Susd2 UTSW 10 75640572 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGGGGCTCTTGTCTACTACC -3'
(R):5'- GCTCTATGACGTCATCAGCTTC -3'

Sequencing Primer
(F):5'- TGGATGATCCAGCAGTGC -3'
(R):5'- ATGACGTCATCAGCTTCTATTACTG -3'
Posted On2015-07-07