Incidental Mutation 'R4354:Nprl3'
ID 327455
Institutional Source Beutler Lab
Gene Symbol Nprl3
Ensembl Gene ENSMUSG00000020289
Gene Name nitrogen permease regulator-like 3
Synonyms Mare, HS-26, Prox1, Phg, -14 gene, HS-40, m(alpha)RE
MMRRC Submission 041107-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.224) question?
Stock # R4354 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 32181963-32217707 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 32184906 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 368 (M368L)
Ref Sequence ENSEMBL: ENSMUSP00000105016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020528] [ENSMUST00000020530] [ENSMUST00000109389] [ENSMUST00000124640] [ENSMUST00000141859] [ENSMUST00000138050] [ENSMUST00000137950] [ENSMUST00000149526] [ENSMUST00000136903] [ENSMUST00000142964]
AlphaFold Q8VIJ8
Predicted Effect probably benign
Transcript: ENSMUST00000020528
SMART Domains Protein: ENSMUSP00000020528
Gene: ENSMUSG00000020287

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
Pfam:Pur_DNA_glyco 109 304 1.2e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020530
AA Change: M393L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020530
Gene: ENSMUSG00000020289
AA Change: M393L

DomainStartEndE-ValueType
Blast:DSPc 1 77 3e-27 BLAST
Pfam:NPR3 104 418 1.8e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109389
AA Change: M368L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000105016
Gene: ENSMUSG00000020289
AA Change: M368L

DomainStartEndE-ValueType
Pfam:NPR3 63 108 8.3e-15 PFAM
Pfam:NPR3 104 395 3.1e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109390
Predicted Effect probably benign
Transcript: ENSMUST00000124640
SMART Domains Protein: ENSMUSP00000122085
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 68 2e-30 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125256
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148636
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129573
Predicted Effect probably benign
Transcript: ENSMUST00000141859
SMART Domains Protein: ENSMUSP00000120341
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 59 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000138050
SMART Domains Protein: ENSMUSP00000121960
Gene: ENSMUSG00000020287

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
SCOP:d1ewna_ 102 125 5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137950
SMART Domains Protein: ENSMUSP00000115594
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 68 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149526
SMART Domains Protein: ENSMUSP00000122231
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Pfam:NPR3 8 72 2.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136903
Predicted Effect probably benign
Transcript: ENSMUST00000142964
SMART Domains Protein: ENSMUSP00000118208
Gene: ENSMUSG00000020287

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
SCOP:d1ewna_ 102 125 5e-4 SMART
Meta Mutation Damage Score 0.1943 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of the encoded protein is not known. [provided by RefSeq, Aug 2011]
PHENOTYPE: This gene is deleted in the Hbath-J mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 64,210,658 (GRCm39) R190H probably benign Het
Abca8b A C 11: 109,862,518 (GRCm39) S416A probably benign Het
Abcb4 A T 5: 8,968,771 (GRCm39) N370I probably benign Het
Abi3bp T C 16: 56,353,314 (GRCm39) F81S probably benign Het
Ablim1 C T 19: 57,143,710 (GRCm39) C83Y probably damaging Het
Adamtsl1 A T 4: 86,074,921 (GRCm39) H96L probably damaging Het
Alms1-ps1 C T 6: 85,732,617 (GRCm39) noncoding transcript Het
AU040320 A G 4: 126,748,192 (GRCm39) probably benign Het
Chd1 T A 17: 17,610,263 (GRCm39) H472Q probably benign Het
Chgb A T 2: 132,635,864 (GRCm39) D602V probably damaging Het
Fhdc1 C A 3: 84,352,133 (GRCm39) V1031F probably benign Het
Gpa33 A G 1: 165,991,404 (GRCm39) T212A possibly damaging Het
Hspg2 C A 4: 137,196,222 (GRCm39) A17E probably benign Het
Irf7 T C 7: 140,845,183 (GRCm39) R8G probably damaging Het
Kcnv1 G A 15: 44,977,840 (GRCm39) T66M probably damaging Het
Loxhd1 T C 18: 77,483,123 (GRCm39) Y1235H probably damaging Het
Mon2 T C 10: 122,862,888 (GRCm39) T680A probably benign Het
Nab1 A T 1: 52,529,855 (GRCm39) L14Q probably damaging Het
Neu4 C T 1: 93,952,279 (GRCm39) T216I probably damaging Het
Nle1 A G 11: 82,797,257 (GRCm39) C152R possibly damaging Het
Nudt9 A G 5: 104,205,977 (GRCm39) K129E probably damaging Het
Or5c1 T C 2: 37,221,888 (GRCm39) L43P probably damaging Het
Pdzd8 T C 19: 59,333,913 (GRCm39) D36G probably benign Het
Pga5 C T 19: 10,652,190 (GRCm39) probably null Het
Pold3 T C 7: 99,749,824 (GRCm39) K47E possibly damaging Het
Ptgir A G 7: 16,640,794 (GRCm39) M29V possibly damaging Het
Rab3gap1 A G 1: 127,843,378 (GRCm39) I251V probably benign Het
Susd2 G T 10: 75,475,562 (GRCm39) F447L probably damaging Het
Tbc1d7 T C 13: 43,323,344 (GRCm39) K16E probably damaging Het
Tlr8 T G X: 166,025,868 (GRCm39) Q994P probably damaging Het
Ube2j1 T C 4: 33,049,682 (GRCm39) Y227H probably benign Het
Other mutations in Nprl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02410:Nprl3 APN 11 32,217,539 (GRCm39) start codon destroyed probably null 0.99
IGL03055:Nprl3 APN 11 32,198,230 (GRCm39) intron probably benign
IGL03366:Nprl3 APN 11 32,200,256 (GRCm39) missense probably damaging 1.00
R0114:Nprl3 UTSW 11 32,189,784 (GRCm39) unclassified probably benign
R0555:Nprl3 UTSW 11 32,183,118 (GRCm39) critical splice acceptor site probably null
R0620:Nprl3 UTSW 11 32,184,876 (GRCm39) missense probably damaging 1.00
R2008:Nprl3 UTSW 11 32,182,973 (GRCm39) missense probably damaging 0.97
R2172:Nprl3 UTSW 11 32,184,894 (GRCm39) missense probably benign 0.00
R2884:Nprl3 UTSW 11 32,198,163 (GRCm39) missense probably damaging 1.00
R3713:Nprl3 UTSW 11 32,205,464 (GRCm39) missense probably damaging 0.98
R3836:Nprl3 UTSW 11 32,183,082 (GRCm39) missense probably damaging 1.00
R6052:Nprl3 UTSW 11 32,205,453 (GRCm39) missense possibly damaging 0.92
R6056:Nprl3 UTSW 11 32,217,432 (GRCm39) missense probably damaging 0.98
R6307:Nprl3 UTSW 11 32,189,828 (GRCm39) missense probably damaging 1.00
R6553:Nprl3 UTSW 11 32,184,812 (GRCm39) missense probably benign
R6585:Nprl3 UTSW 11 32,184,812 (GRCm39) missense probably benign
R6774:Nprl3 UTSW 11 32,187,381 (GRCm39) missense probably damaging 1.00
R6806:Nprl3 UTSW 11 32,217,509 (GRCm39) missense probably damaging 0.99
R7746:Nprl3 UTSW 11 32,198,150 (GRCm39) nonsense probably null
R7980:Nprl3 UTSW 11 32,187,357 (GRCm39) missense probably damaging 1.00
R8483:Nprl3 UTSW 11 32,213,083 (GRCm39) missense probably damaging 1.00
R8712:Nprl3 UTSW 11 32,187,334 (GRCm39) missense possibly damaging 0.84
R8827:Nprl3 UTSW 11 32,184,742 (GRCm39) missense probably benign 0.00
R9264:Nprl3 UTSW 11 32,183,948 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCATTACCAGACAGATGTCCTG -3'
(R):5'- GTATGCTGACCTTGCAGAGC -3'

Sequencing Primer
(F):5'- ATGTCCTGGAAGGGGATCCTAC -3'
(R):5'- TGACCTTGCAGAGCTACCCAG -3'
Posted On 2015-07-07