Incidental Mutation 'R4354:Nle1'
ID327456
Institutional Source Beutler Lab
Gene Symbol Nle1
Ensembl Gene ENSMUSG00000020692
Gene Namenotchless homolog 1
Synonymsnotchless, Nle, l11Jus4, l11Jus1
MMRRC Submission 041107-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4354 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location82900768-82908411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82906431 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 152 (C152R)
Ref Sequence ENSEMBL: ENSMUSP00000099502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018989] [ENSMUST00000103213] [ENSMUST00000108160] [ENSMUST00000164945]
Predicted Effect probably benign
Transcript: ENSMUST00000018989
SMART Domains Protein: ENSMUSP00000018989
Gene: ENSMUSG00000018845

DomainStartEndE-ValueType
TPR 6 39 1.02e1 SMART
TPR 43 76 7.47e0 SMART
TPR 77 110 2.52e-1 SMART
Blast:ARM 167 208 3e-16 BLAST
Blast:ARM 210 250 1e-10 BLAST
Pfam:UNC45-central 298 489 1.7e-41 PFAM
Blast:ARM 541 582 7e-7 BLAST
Blast:ARM 661 701 2e-14 BLAST
Blast:ARM 704 746 5e-11 BLAST
Blast:ARM 747 788 1e-20 BLAST
Blast:ARM 789 820 1e-11 BLAST
low complexity region 821 832 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103213
AA Change: C152R

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099502
Gene: ENSMUSG00000020692
AA Change: C152R

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:NLE 17 77 3.6e-15 PFAM
WD40 103 142 5.22e-12 SMART
WD40 145 184 1.48e-11 SMART
WD40 188 232 1.66e-5 SMART
WD40 235 273 3.11e-10 SMART
WD40 276 357 1.14e-3 SMART
WD40 361 400 8.81e-10 SMART
WD40 403 442 1.69e-11 SMART
WD40 445 484 9.44e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108160
SMART Domains Protein: ENSMUSP00000103795
Gene: ENSMUSG00000018845

DomainStartEndE-ValueType
TPR 6 39 1.02e1 SMART
TPR 43 76 7.47e0 SMART
TPR 77 110 2.52e-1 SMART
Blast:ARM 167 208 3e-16 BLAST
Blast:ARM 210 250 1e-10 BLAST
Pfam:UNC45-central 271 489 2.2e-52 PFAM
Blast:ARM 663 703 2e-14 BLAST
Blast:ARM 706 748 5e-11 BLAST
Blast:ARM 749 790 1e-20 BLAST
Blast:ARM 791 822 1e-11 BLAST
low complexity region 823 834 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124109
Predicted Effect probably benign
Transcript: ENSMUST00000126202
SMART Domains Protein: ENSMUSP00000130605
Gene: ENSMUSG00000020692

DomainStartEndE-ValueType
SCOP:d1flga_ 12 46 2e-5 SMART
Blast:WD40 22 48 2e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147915
Predicted Effect probably benign
Transcript: ENSMUST00000164945
SMART Domains Protein: ENSMUSP00000129405
Gene: ENSMUSG00000018845

DomainStartEndE-ValueType
TPR 6 39 1.02e1 SMART
TPR 43 76 7.47e0 SMART
TPR 77 110 2.52e-1 SMART
Blast:ARM 167 208 3e-16 BLAST
Blast:ARM 210 250 1e-10 BLAST
Pfam:UNC45-central 298 489 1.7e-41 PFAM
Blast:ARM 663 703 2e-14 BLAST
Blast:ARM 706 748 5e-11 BLAST
Blast:ARM 749 790 1e-20 BLAST
Blast:ARM 791 822 1e-11 BLAST
low complexity region 823 834 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170815
Meta Mutation Damage Score 0.7611 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (37/38)
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation, most blastocysts fail to hatch out of the zona pellucida, and apoptosis is increased in the inner cell mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
Abca8b A C 11: 109,971,692 S416A probably benign Het
Abcb4 A T 5: 8,918,771 N370I probably benign Het
Abi3bp T C 16: 56,532,951 F81S probably benign Het
Ablim1 C T 19: 57,155,278 C83Y probably damaging Het
Adamtsl1 A T 4: 86,156,684 H96L probably damaging Het
Alms1-ps1 C T 6: 85,755,635 noncoding transcript Het
AU040320 A G 4: 126,854,399 probably benign Het
Chd1 T A 17: 17,390,001 H472Q probably benign Het
Chgb A T 2: 132,793,944 D602V probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gpa33 A G 1: 166,163,835 T212A possibly damaging Het
Hspg2 C A 4: 137,468,911 A17E probably benign Het
Irf7 T C 7: 141,265,270 R8G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Loxhd1 T C 18: 77,395,427 Y1235H probably damaging Het
Mon2 T C 10: 123,026,983 T680A probably benign Het
Nab1 A T 1: 52,490,696 L14Q probably damaging Het
Neu4 C T 1: 94,024,557 T216I probably damaging Het
Nprl3 T A 11: 32,234,906 M368L probably benign Het
Nudt9 A G 5: 104,058,111 K129E probably damaging Het
Olfr368 T C 2: 37,331,876 L43P probably damaging Het
Pdzd8 T C 19: 59,345,481 D36G probably benign Het
Pga5 C T 19: 10,674,826 probably null Het
Pold3 T C 7: 100,100,617 K47E possibly damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rab3gap1 A G 1: 127,915,641 I251V probably benign Het
Susd2 G T 10: 75,639,728 F447L probably damaging Het
Tbc1d7 T C 13: 43,169,868 K16E probably damaging Het
Tlr8 T G X: 167,242,872 Q994P probably damaging Het
Ube2j1 T C 4: 33,049,682 Y227H probably benign Het
Other mutations in Nle1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02226:Nle1 APN 11 82904307 nonsense probably null
IGL02945:Nle1 APN 11 82904084 splice site probably benign
IGL03170:Nle1 APN 11 82904270 missense probably benign
R0401:Nle1 UTSW 11 82905379 unclassified probably benign
R0646:Nle1 UTSW 11 82904845 missense probably damaging 1.00
R1958:Nle1 UTSW 11 82904242 missense probably benign 0.01
R1966:Nle1 UTSW 11 82901788 missense probably damaging 1.00
R2016:Nle1 UTSW 11 82905547 missense probably damaging 1.00
R2017:Nle1 UTSW 11 82905547 missense probably damaging 1.00
R2049:Nle1 UTSW 11 82905366 missense probably damaging 1.00
R2140:Nle1 UTSW 11 82905568 missense probably damaging 0.99
R2289:Nle1 UTSW 11 82903053 missense probably benign 0.01
R4963:Nle1 UTSW 11 82904937 missense probably benign 0.04
R4964:Nle1 UTSW 11 82908192 missense probably damaging 1.00
R5257:Nle1 UTSW 11 82904946 missense probably damaging 1.00
R5258:Nle1 UTSW 11 82904946 missense probably damaging 1.00
R5509:Nle1 UTSW 11 82903182 missense possibly damaging 0.92
R6160:Nle1 UTSW 11 82908157 missense probably benign 0.01
R7206:Nle1 UTSW 11 82904931 missense probably benign 0.35
R7696:Nle1 UTSW 11 82904966 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAGAGCCTTTTCAAGCTGTC -3'
(R):5'- CCAGAAGATGGTTGGCTAGG -3'

Sequencing Primer
(F):5'- ACAACCAGTAGTTTAGCTCCTC -3'
(R):5'- CTAGGCAGCAGGAATACCCATG -3'
Posted On2015-07-07