Mutagenetix > Incidental Mutations

Incidental Mutation 'R4354:Abi3bp'

327461

Institutional Source

Beutler Lab

Gene Symbol

Abi3bp

Ensembl Gene

ENSMUSG00000035258

Gene Name

ABI gene family, member 3 (NESH) binding protein

Synonyms

D930038M13Rik, eratin, TARSH, 5033411B22Rik

MMRRC Submission

041107-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R4354 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

56477878-56690135 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 56532951 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 81 (F81S)

Ref Sequence

ENSEMBL: ENSMUSP00000156096 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048471] [ENSMUST00000096012] [ENSMUST00000096013] [ENSMUST00000171000] [ENSMUST00000231781] [ENSMUST00000231832] [ENSMUST00000231870]

Predicted Effect

probably benign
Transcript: ENSMUST00000048471
AA Change: F81S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000036257
Gene: ENSMUSG00000035258
AA Change: F81S

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
FN3	114	203	3.08e-2	SMART
low complexity region	433	446	N/A	INTRINSIC
low complexity region	516	528	N/A	INTRINSIC
low complexity region	579	591	N/A	INTRINSIC
low complexity region	734	747	N/A	INTRINSIC
low complexity region	751	764	N/A	INTRINSIC
FN3	941	1024	6.29e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000096012
AA Change: F81S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000093711
Gene: ENSMUSG00000035258
AA Change: F81S

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
FN3	114	203	3.08e-2	SMART
low complexity region	433	446	N/A	INTRINSIC
low complexity region	634	647	N/A	INTRINSIC
low complexity region	651	664	N/A	INTRINSIC
FN3	841	924	6.29e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000096013
AA Change: F81S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000093712
Gene: ENSMUSG00000035258
AA Change: F81S

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
FN3	114	203	3.08e-2	SMART
low complexity region	433	446	N/A	INTRINSIC
low complexity region	670	683	N/A	INTRINSIC
low complexity region	687	700	N/A	INTRINSIC
FN3	877	960	6.29e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000171000
AA Change: F81S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000128818
Gene: ENSMUSG00000035258
AA Change: F81S

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
FN3	114	203	3.08e-2	SMART
low complexity region	464	477	N/A	INTRINSIC
low complexity region	481	494	N/A	INTRINSIC
FN3	671	754	6.29e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231337

Predicted Effect

probably benign
Transcript: ENSMUST00000231781
AA Change: F81S

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)

Predicted Effect

probably benign
Transcript: ENSMUST00000231832
AA Change: F81S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000231870
AA Change: F81S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

Meta Mutation Damage Score

0.0679

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

97% (37/38)

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930578I06Rik	C	T	14: 63,973,209	R190H	probably benign	Het
Abca8b	A	C	11: 109,971,692	S416A	probably benign	Het
Abcb4	A	T	5: 8,918,771	N370I	probably benign	Het
Ablim1	C	T	19: 57,155,278	C83Y	probably damaging	Het
Adamtsl1	A	T	4: 86,156,684	H96L	probably damaging	Het
Alms1-ps1	C	T	6: 85,755,635		noncoding transcript	Het
AU040320	A	G	4: 126,854,399		probably benign	Het
Chd1	T	A	17: 17,390,001	H472Q	probably benign	Het
Chgb	A	T	2: 132,793,944	D602V	probably damaging	Het
Fhdc1	C	A	3: 84,444,826	V1031F	probably benign	Het
Gpa33	A	G	1: 166,163,835	T212A	possibly damaging	Het
Hspg2	C	A	4: 137,468,911	A17E	probably benign	Het
Irf7	T	C	7: 141,265,270	R8G	probably damaging	Het
Kcnv1	G	A	15: 45,114,444	T66M	probably damaging	Het
Loxhd1	T	C	18: 77,395,427	Y1235H	probably damaging	Het
Mon2	T	C	10: 123,026,983	T680A	probably benign	Het
Nab1	A	T	1: 52,490,696	L14Q	probably damaging	Het
Neu4	C	T	1: 94,024,557	T216I	probably damaging	Het
Nle1	A	G	11: 82,906,431	C152R	possibly damaging	Het
Nprl3	T	A	11: 32,234,906	M368L	probably benign	Het
Nudt9	A	G	5: 104,058,111	K129E	probably damaging	Het
Olfr368	T	C	2: 37,331,876	L43P	probably damaging	Het
Pdzd8	T	C	19: 59,345,481	D36G	probably benign	Het
Pga5	C	T	19: 10,674,826		probably null	Het
Pold3	T	C	7: 100,100,617	K47E	possibly damaging	Het
Ptgir	A	G	7: 16,906,869	M29V	possibly damaging	Het
Rab3gap1	A	G	1: 127,915,641	I251V	probably benign	Het
Susd2	G	T	10: 75,639,728	F447L	probably damaging	Het
Tbc1d7	T	C	13: 43,169,868	K16E	probably damaging	Het
Tlr8	T	G	X: 167,242,872	Q994P	probably damaging	Het
Ube2j1	T	C	4: 33,049,682	Y227H	probably benign	Het

Other mutations in Abi3bp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Abi3bp	APN	16	56602805	missense	probably null	0.99
IGL01580:Abi3bp	APN	16	56675210	missense	probably damaging	1.00
IGL01633:Abi3bp	APN	16	56677800	missense	probably damaging	1.00
IGL01783:Abi3bp	APN	16	56532969	critical splice donor site	probably null
IGL01866:Abi3bp	APN	16	56671973	missense	probably benign	0.19
IGL02022:Abi3bp	APN	16	56592636	missense	probably damaging	1.00
IGL02086:Abi3bp	APN	16	56642567	splice site	probably benign
IGL02122:Abi3bp	APN	16	56687128	splice site	probably benign
IGL02155:Abi3bp	APN	16	56587964	missense	probably damaging	0.99
IGL02351:Abi3bp	APN	16	56654055	missense	possibly damaging	0.91
IGL02358:Abi3bp	APN	16	56654055	missense	possibly damaging	0.91
IGL02418:Abi3bp	APN	16	56604116	splice site	probably benign
IGL02559:Abi3bp	APN	16	56687070	nonsense	probably null
IGL02617:Abi3bp	APN	16	56574444	nonsense	probably null
IGL02810:Abi3bp	APN	16	56677775	missense	probably damaging	1.00
IGL03057:Abi3bp	APN	16	56668391	missense	possibly damaging	0.95
IGL03174:Abi3bp	APN	16	56614747	missense	possibly damaging	0.64
R0389:Abi3bp	UTSW	16	56671307	missense	possibly damaging	0.79
R0485:Abi3bp	UTSW	16	56604012	intron	probably null
R0557:Abi3bp	UTSW	16	56668387	missense	probably damaging	0.97
R0616:Abi3bp	UTSW	16	56654070	missense	probably damaging	0.99
R0685:Abi3bp	UTSW	16	56532953	missense	possibly damaging	0.90
R0783:Abi3bp	UTSW	16	56595238	critical splice acceptor site	probably null
R0828:Abi3bp	UTSW	16	56677830	missense	probably damaging	1.00
R0841:Abi3bp	UTSW	16	56668276	missense	possibly damaging	0.95
R1078:Abi3bp	UTSW	16	56654081	critical splice donor site	probably null
R1101:Abi3bp	UTSW	16	56606158	missense	probably damaging	1.00
R1116:Abi3bp	UTSW	16	56686429	splice site	probably benign
R1145:Abi3bp	UTSW	16	56668276	missense	possibly damaging	0.95
R1145:Abi3bp	UTSW	16	56668276	missense	possibly damaging	0.95
R1317:Abi3bp	UTSW	16	56668309	missense	possibly damaging	0.79
R1384:Abi3bp	UTSW	16	56574499	missense	probably damaging	1.00
R1460:Abi3bp	UTSW	16	56562417	missense	probably damaging	0.99
R1730:Abi3bp	UTSW	16	56668279	missense	possibly damaging	0.62
R1761:Abi3bp	UTSW	16	56668309	missense	possibly damaging	0.79
R1830:Abi3bp	UTSW	16	56587985	missense	probably damaging	1.00
R1873:Abi3bp	UTSW	16	56574499	missense	probably damaging	1.00
R1875:Abi3bp	UTSW	16	56574499	missense	probably damaging	1.00
R1996:Abi3bp	UTSW	16	56671357	missense	possibly damaging	0.61
R2018:Abi3bp	UTSW	16	56677796	missense	probably damaging	1.00
R2019:Abi3bp	UTSW	16	56677796	missense	probably damaging	1.00
R2035:Abi3bp	UTSW	16	56660218	missense	probably benign	0.21
R2118:Abi3bp	UTSW	16	56477864	unclassified	probably benign
R2202:Abi3bp	UTSW	16	56613203	missense	probably benign	0.06
R2202:Abi3bp	UTSW	16	56650725	nonsense	probably null
R2203:Abi3bp	UTSW	16	56613203	missense	probably benign	0.06
R3030:Abi3bp	UTSW	16	56657319	missense	possibly damaging	0.79
R3952:Abi3bp	UTSW	16	56604038	missense	possibly damaging	0.88
R4176:Abi3bp	UTSW	16	56652200	missense	probably damaging	0.96
R4296:Abi3bp	UTSW	16	56668310	missense	probably benign	0.05
R4301:Abi3bp	UTSW	16	56556903	missense	probably damaging	1.00
R4417:Abi3bp	UTSW	16	56654035	missense	probably damaging	1.00
R4716:Abi3bp	UTSW	16	56650725	nonsense	probably null
R4808:Abi3bp	UTSW	16	56594516	missense	probably damaging	0.96
R4814:Abi3bp	UTSW	16	56650753	missense	probably benign	0.06
R5016:Abi3bp	UTSW	16	56671268	missense	probably damaging	0.97
R5290:Abi3bp	UTSW	16	56642475	splice site	probably null
R5891:Abi3bp	UTSW	16	56606133	missense	probably damaging	1.00
R5897:Abi3bp	UTSW	16	56604669	missense	possibly damaging	0.53
R6146:Abi3bp	UTSW	16	56671265	missense	probably damaging	0.99
R6267:Abi3bp	UTSW	16	56594497	missense	probably damaging	0.97
R6905:Abi3bp	UTSW	16	56574517	missense	probably damaging	1.00
R6908:Abi3bp	UTSW	16	56657305	missense	probably benign	0.01
R6917:Abi3bp	UTSW	16	56617321	intron	probably null
R7071:Abi3bp	UTSW	16	56629140	nonsense	probably null
R7194:Abi3bp	UTSW	16	56562371	missense	probably damaging	0.99
R7476:Abi3bp	UTSW	16	56614746	nonsense	probably null
R7554:Abi3bp	UTSW	16	56618212	splice site	probably null
R7571:Abi3bp	UTSW	16	56630982	splice site	probably null
RF008:Abi3bp	UTSW	16	56627589	intron	probably benign
RF016:Abi3bp	UTSW	16	56627587	frame shift	probably null
RF052:Abi3bp	UTSW	16	56627585	intron	probably benign
RF061:Abi3bp	UTSW	16	56627587	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CTTCCAGCAAGCAAGGGTTG -3'
(R):5'- GCTCCAGGTTCCAGTTACAAAG -3'

Sequencing Primer
(F):5'- GGGTGAAATATCAGGCACTTACC -3'
(R):5'- CAAAGGTGATTTGTGTTGCCAC -3'

Posted On

2015-07-07