Incidental Mutation 'R4354:Chd1'
ID327462
Institutional Source Beutler Lab
Gene Symbol Chd1
Ensembl Gene ENSMUSG00000023852
Gene Namechromodomain helicase DNA binding protein 1
Synonyms4930525N21Rik
MMRRC Submission 041107-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4354 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location15704967-15772610 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 17390001 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 472 (H472Q)
Ref Sequence ENSEMBL: ENSMUSP00000024620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024620] [ENSMUST00000232199] [ENSMUST00000232396]
Predicted Effect probably benign
Transcript: ENSMUST00000024620
AA Change: H472Q

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000024620
Gene: ENSMUSG00000116564
AA Change: H472Q

DomainStartEndE-ValueType
Pfam:Rio2_N 9 91 9.5e-36 PFAM
Pfam:Kdo 105 193 6.3e-8 PFAM
Pfam:RIO1 108 284 1.7e-57 PFAM
Pfam:APH 194 278 3.2e-8 PFAM
low complexity region 326 340 N/A INTRINSIC
low complexity region 501 518 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181390
Predicted Effect probably benign
Transcript: ENSMUST00000232199
Predicted Effect probably benign
Transcript: ENSMUST00000232396
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with arrest of epiblast development due to increased apoptosis and cell cycle defects, abnormal rostral-caudal axis patterning, and failure to gastrulate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
Abca8b A C 11: 109,971,692 S416A probably benign Het
Abcb4 A T 5: 8,918,771 N370I probably benign Het
Abi3bp T C 16: 56,532,951 F81S probably benign Het
Ablim1 C T 19: 57,155,278 C83Y probably damaging Het
Adamtsl1 A T 4: 86,156,684 H96L probably damaging Het
Alms1-ps1 C T 6: 85,755,635 noncoding transcript Het
AU040320 A G 4: 126,854,399 probably benign Het
Chgb A T 2: 132,793,944 D602V probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gpa33 A G 1: 166,163,835 T212A possibly damaging Het
Hspg2 C A 4: 137,468,911 A17E probably benign Het
Irf7 T C 7: 141,265,270 R8G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Loxhd1 T C 18: 77,395,427 Y1235H probably damaging Het
Mon2 T C 10: 123,026,983 T680A probably benign Het
Nab1 A T 1: 52,490,696 L14Q probably damaging Het
Neu4 C T 1: 94,024,557 T216I probably damaging Het
Nle1 A G 11: 82,906,431 C152R possibly damaging Het
Nprl3 T A 11: 32,234,906 M368L probably benign Het
Nudt9 A G 5: 104,058,111 K129E probably damaging Het
Olfr368 T C 2: 37,331,876 L43P probably damaging Het
Pdzd8 T C 19: 59,345,481 D36G probably benign Het
Pga5 C T 19: 10,674,826 probably null Het
Pold3 T C 7: 100,100,617 K47E possibly damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rab3gap1 A G 1: 127,915,641 I251V probably benign Het
Susd2 G T 10: 75,639,728 F447L probably damaging Het
Tbc1d7 T C 13: 43,169,868 K16E probably damaging Het
Tlr8 T G X: 167,242,872 Q994P probably damaging Het
Ube2j1 T C 4: 33,049,682 Y227H probably benign Het
Other mutations in Chd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Chd1 APN 17 15732565 missense probably benign 0.37
IGL01356:Chd1 APN 17 15749865 missense probably damaging 1.00
IGL01369:Chd1 APN 17 15754997 missense probably damaging 0.97
IGL01519:Chd1 APN 17 17378569 missense probably damaging 1.00
IGL01604:Chd1 APN 17 15770097 missense possibly damaging 0.95
IGL01635:Chd1 APN 17 17378596 missense probably damaging 1.00
IGL01721:Chd1 APN 17 15770168 missense probably damaging 1.00
IGL01959:Chd1 APN 17 15742173 missense probably damaging 1.00
IGL02367:Chd1 APN 17 17390053 missense probably damaging 0.98
IGL02476:Chd1 APN 17 15734273 missense probably damaging 1.00
IGL02756:Chd1 APN 17 15730807 missense probably damaging 0.97
IGL02817:Chd1 APN 17 15749500 missense possibly damaging 0.92
IGL03084:Chd1 APN 17 15770298 missense probably benign 0.22
IGL03108:Chd1 APN 17 15725281 missense possibly damaging 0.70
Holly UTSW 17 15726283 missense possibly damaging 0.72
R0053:Chd1 UTSW 17 15747189 missense probably damaging 1.00
R0053:Chd1 UTSW 17 15747189 missense probably damaging 1.00
R0128:Chd1 UTSW 17 17393567 missense probably damaging 1.00
R0197:Chd1 UTSW 17 15725431 missense probably benign
R0285:Chd1 UTSW 17 17374680 splice site probably benign
R0326:Chd1 UTSW 17 15768566 missense probably damaging 1.00
R0326:Chd1 UTSW 17 15768568 missense probably benign
R0372:Chd1 UTSW 17 17387290 missense probably benign 0.14
R0391:Chd1 UTSW 17 15749894 missense probably damaging 1.00
R0486:Chd1 UTSW 17 15734342 missense probably damaging 0.99
R0637:Chd1 UTSW 17 15742288 missense possibly damaging 0.50
R0675:Chd1 UTSW 17 15758261 unclassified probably benign
R0701:Chd1 UTSW 17 15725431 missense probably benign
R0788:Chd1 UTSW 17 15707114 missense possibly damaging 0.86
R0848:Chd1 UTSW 17 15770241 missense probably damaging 1.00
R0883:Chd1 UTSW 17 15725431 missense probably benign
R1169:Chd1 UTSW 17 15735732 missense probably damaging 1.00
R1218:Chd1 UTSW 17 15725312 missense probably damaging 1.00
R1370:Chd1 UTSW 17 17387480 missense probably benign 0.00
R1470:Chd1 UTSW 17 15726283 missense possibly damaging 0.72
R1470:Chd1 UTSW 17 15726283 missense possibly damaging 0.72
R1478:Chd1 UTSW 17 15739507 missense probably damaging 0.99
R1752:Chd1 UTSW 17 15743232 critical splice donor site probably null
R1759:Chd1 UTSW 17 17387271 missense probably benign 0.00
R1767:Chd1 UTSW 17 15770303 missense probably damaging 1.00
R1938:Chd1 UTSW 17 15762486 missense probably benign 0.39
R2007:Chd1 UTSW 17 15731006 missense probably damaging 1.00
R2069:Chd1 UTSW 17 15742294 missense probably damaging 1.00
R3771:Chd1 UTSW 17 17374651 missense probably damaging 1.00
R3773:Chd1 UTSW 17 17374651 missense probably damaging 1.00
R3849:Chd1 UTSW 17 15731871 missense probably damaging 1.00
R4241:Chd1 UTSW 17 15770027 nonsense probably null
R4242:Chd1 UTSW 17 15770027 nonsense probably null
R4468:Chd1 UTSW 17 15760395 missense probably damaging 0.99
R4469:Chd1 UTSW 17 15760395 missense probably damaging 0.99
R4731:Chd1 UTSW 17 17377817 missense probably benign 0.36
R4824:Chd1 UTSW 17 15733124 missense probably damaging 1.00
R4840:Chd1 UTSW 17 15768753 nonsense probably null
R4840:Chd1 UTSW 17 15768754 missense probably damaging 1.00
R4880:Chd1 UTSW 17 17374654 missense probably damaging 1.00
R4960:Chd1 UTSW 17 15742231 missense probably damaging 0.96
R5071:Chd1 UTSW 17 15762405 missense probably benign
R5078:Chd1 UTSW 17 15726354 missense possibly damaging 0.93
R5114:Chd1 UTSW 17 15728198 missense probably benign 0.25
R5268:Chd1 UTSW 17 15735743 missense probably damaging 1.00
R5304:Chd1 UTSW 17 15754951 missense probably benign 0.01
R5304:Chd1 UTSW 17 15770268 missense possibly damaging 0.55
R5307:Chd1 UTSW 17 15732570 missense probably damaging 1.00
R5458:Chd1 UTSW 17 15738549 missense probably damaging 1.00
R5553:Chd1 UTSW 17 17385613 missense probably benign 0.17
R5623:Chd1 UTSW 17 15754932 missense probably damaging 1.00
R6022:Chd1 UTSW 17 17377773 missense probably benign 0.39
R6137:Chd1 UTSW 17 15758688 missense probably damaging 1.00
R6257:Chd1 UTSW 17 15730203 splice site probably null
R6373:Chd1 UTSW 17 15738636 missense probably damaging 1.00
R6458:Chd1 UTSW 17 15730602 missense probably benign 0.01
R6476:Chd1 UTSW 17 17380988 critical splice donor site probably null
R6508:Chd1 UTSW 17 15738633 missense probably benign 0.31
R6553:Chd1 UTSW 17 15725430 missense probably benign 0.00
R6745:Chd1 UTSW 17 17387167 missense probably benign 0.08
R7107:Chd1 UTSW 17 15761366 missense probably damaging 0.98
R7230:Chd1 UTSW 17 15706937 splice site probably null
R7317:Chd1 UTSW 17 15742274 missense possibly damaging 0.71
R7341:Chd1 UTSW 17 15770237 missense probably damaging 0.99
R7421:Chd1 UTSW 17 15749398 missense probably benign 0.03
R7704:Chd1 UTSW 17 15767475 missense probably benign
R7763:Chd1 UTSW 17 15733041 missense probably damaging 1.00
R8156:Chd1 UTSW 17 15761404 missense probably benign
R8194:Chd1 UTSW 17 17374475 start gained probably benign
R8261:Chd1 UTSW 17 17387542 missense probably benign 0.02
R8338:Chd1 UTSW 17 15769980 missense probably damaging 1.00
R8401:Chd1 UTSW 17 15743211 missense probably damaging 1.00
R8411:Chd1 UTSW 17 15762449 missense probably damaging 0.98
Z1176:Chd1 UTSW 17 15766347 missense probably damaging 0.98
Z1176:Chd1 UTSW 17 15768733 missense probably damaging 1.00
Z1177:Chd1 UTSW 17 15747801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTATAGTGGACTGAGTTGTAGGTAG -3'
(R):5'- GGTGAAAACTTCTACATGCTGAC -3'

Sequencing Primer
(F):5'- CTGAGGCATTTCACTTTATGC -3'
(R):5'- CATGCTGACCATGTTATAACATTAAC -3'
Posted On2015-07-07