Incidental Mutation 'R4354:Pga5'
ID327464
Institutional Source Beutler Lab
Gene Symbol Pga5
Ensembl Gene ENSMUSG00000024738
Gene Namepepsinogen 5, group I
Synonyms1110035E17Rik, Pepf, pepsinogen A5
MMRRC Submission 041107-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4354 (G1)
Quality Score221
Status Validated
Chromosome19
Chromosomal Location10668956-10678071 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 10674826 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025647]
Predicted Effect probably null
Transcript: ENSMUST00000025647
SMART Domains Protein: ENSMUSP00000025647
Gene: ENSMUSG00000024738

DomainStartEndE-ValueType
Pfam:A1_Propeptide 16 44 1.1e-13 PFAM
Pfam:Asp 73 386 1.1e-112 PFAM
Pfam:TAXi_N 74 229 7.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225135
Meta Mutation Damage Score 0.9363 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
Abca8b A C 11: 109,971,692 S416A probably benign Het
Abcb4 A T 5: 8,918,771 N370I probably benign Het
Abi3bp T C 16: 56,532,951 F81S probably benign Het
Ablim1 C T 19: 57,155,278 C83Y probably damaging Het
Adamtsl1 A T 4: 86,156,684 H96L probably damaging Het
Alms1-ps1 C T 6: 85,755,635 noncoding transcript Het
AU040320 A G 4: 126,854,399 probably benign Het
Chd1 T A 17: 17,390,001 H472Q probably benign Het
Chgb A T 2: 132,793,944 D602V probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gpa33 A G 1: 166,163,835 T212A possibly damaging Het
Hspg2 C A 4: 137,468,911 A17E probably benign Het
Irf7 T C 7: 141,265,270 R8G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Loxhd1 T C 18: 77,395,427 Y1235H probably damaging Het
Mon2 T C 10: 123,026,983 T680A probably benign Het
Nab1 A T 1: 52,490,696 L14Q probably damaging Het
Neu4 C T 1: 94,024,557 T216I probably damaging Het
Nle1 A G 11: 82,906,431 C152R possibly damaging Het
Nprl3 T A 11: 32,234,906 M368L probably benign Het
Nudt9 A G 5: 104,058,111 K129E probably damaging Het
Olfr368 T C 2: 37,331,876 L43P probably damaging Het
Pdzd8 T C 19: 59,345,481 D36G probably benign Het
Pold3 T C 7: 100,100,617 K47E possibly damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rab3gap1 A G 1: 127,915,641 I251V probably benign Het
Susd2 G T 10: 75,639,728 F447L probably damaging Het
Tbc1d7 T C 13: 43,169,868 K16E probably damaging Het
Tlr8 T G X: 167,242,872 Q994P probably damaging Het
Ube2j1 T C 4: 33,049,682 Y227H probably benign Het
Other mutations in Pga5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01660:Pga5 APN 19 10675092 missense probably damaging 1.00
IGL02037:Pga5 APN 19 10676701 missense probably benign 0.01
IGL02069:Pga5 APN 19 10669399 missense possibly damaging 0.76
IGL02197:Pga5 APN 19 10671913 splice site probably benign
IGL02871:Pga5 APN 19 10671780 splice site probably benign
R0238:Pga5 UTSW 19 10669453 missense probably damaging 1.00
R0238:Pga5 UTSW 19 10669453 missense probably damaging 1.00
R0239:Pga5 UTSW 19 10669453 missense probably damaging 1.00
R0239:Pga5 UTSW 19 10669453 missense probably damaging 1.00
R1573:Pga5 UTSW 19 10673837 missense probably benign 0.13
R1941:Pga5 UTSW 19 10669456 splice site probably null
R4568:Pga5 UTSW 19 10671852 missense probably damaging 1.00
R5119:Pga5 UTSW 19 10676689 missense probably benign 0.00
R5738:Pga5 UTSW 19 10669660 missense probably benign 0.05
R5864:Pga5 UTSW 19 10675149 missense probably damaging 1.00
R6176:Pga5 UTSW 19 10671785 splice site probably null
R6270:Pga5 UTSW 19 10674861 missense probably benign
R6990:Pga5 UTSW 19 10669415 missense probably benign 0.03
Z1176:Pga5 UTSW 19 10669159 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGAGCTACAAATCTGAGCC -3'
(R):5'- ATCTATTGCTCCAGCCCAGC -3'

Sequencing Primer
(F):5'- GCTACAAATCTGAGCCTTGGG -3'
(R):5'- GTGAGCACTCTGATCCGACCTAC -3'
Posted On2015-07-07