Incidental Mutation 'R4355:Col9a3'
ID 327473
Institutional Source Beutler Lab
Gene Symbol Col9a3
Ensembl Gene ENSMUSG00000027570
Gene Name collagen, type IX, alpha 3
Synonyms
MMRRC Submission 041108-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock # R4355 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 180597790-180622189 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 180606478 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 208 (S208G)
Ref Sequence ENSEMBL: ENSMUSP00000128718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103059] [ENSMUST00000132527]
AlphaFold A2ACT7
Predicted Effect probably benign
Transcript: ENSMUST00000103059
AA Change: S208G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099348
Gene: ENSMUSG00000027570
AA Change: S208G

DomainStartEndE-ValueType
Pfam:Collagen 21 80 7.7e-12 PFAM
Pfam:Collagen 58 114 4.2e-9 PFAM
low complexity region 126 162 N/A INTRINSIC
Pfam:Collagen 174 236 4.1e-12 PFAM
Pfam:Collagen 213 292 8e-9 PFAM
internal_repeat_1 315 366 1.58e-12 PROSPERO
internal_repeat_2 360 382 2.94e-6 PROSPERO
low complexity region 384 396 N/A INTRINSIC
Pfam:Collagen 456 518 1.8e-11 PFAM
Pfam:Collagen 545 606 3.8e-11 PFAM
low complexity region 635 656 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129090
Predicted Effect probably benign
Transcript: ENSMUST00000132527
AA Change: S208G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128718
Gene: ENSMUSG00000027570
AA Change: S208G

DomainStartEndE-ValueType
Pfam:Collagen 21 80 7.9e-12 PFAM
Pfam:Collagen 58 114 4.3e-9 PFAM
Pfam:Collagen 109 166 4.5e-8 PFAM
Pfam:Collagen 174 236 4.2e-12 PFAM
Pfam:Collagen 213 292 8.2e-9 PFAM
internal_repeat_1 315 366 1.58e-12 PROSPERO
internal_repeat_2 360 382 2.94e-6 PROSPERO
low complexity region 384 396 N/A INTRINSIC
Pfam:Collagen 402 474 8.2e-8 PFAM
Pfam:Collagen 456 518 1.8e-11 PFAM
Pfam:Collagen 545 606 3.9e-11 PFAM
Pfam:Collagen 603 662 2.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141056
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. Mutations in this gene are associated with multiple epiphyseal dysplasia type 3. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a T G 8: 43,570,185 Q89H probably benign Het
Adgrb1 T C 15: 74,543,662 F697S probably damaging Het
Adgrl2 A T 3: 148,839,152 V769E probably damaging Het
Aldh7a1 A T 18: 56,548,494 F173L probably null Het
Arntl A G 7: 113,303,406 I421V possibly damaging Het
Bcl3 G T 7: 19,811,580 C208* probably null Het
Casz1 T C 4: 148,952,335 S1685P unknown Het
Cep250 A G 2: 155,991,525 E1789G probably damaging Het
Cep76 A T 18: 67,626,640 D334E probably benign Het
Clca3b A T 3: 144,825,458 probably null Het
Ddx47 T C 6: 135,021,505 V388A probably benign Het
Dync1h1 C T 12: 110,632,899 A1896V possibly damaging Het
Eif2ak2 T A 17: 78,858,534 R411S probably benign Het
F7 A G 8: 13,034,774 T267A probably benign Het
Fras1 C A 5: 96,700,242 D1770E probably benign Het
G2e3 T A 12: 51,365,337 Y387N probably benign Het
Hspg2 C T 4: 137,529,418 L1491F probably damaging Het
Ighv3-4 T C 12: 114,253,640 I110M probably benign Het
Itgb5 T A 16: 33,844,997 C28S probably damaging Het
Kbtbd11 C A 8: 15,028,578 N392K probably damaging Het
Kcnmb4 A G 10: 116,473,284 S80P possibly damaging Het
Kif21a C T 15: 90,970,833 C721Y probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klrc3 T C 6: 129,639,162 M189V probably benign Het
Macf1 T A 4: 123,475,091 E394V possibly damaging Het
Mrgprb4 C T 7: 48,198,701 G160R possibly damaging Het
Myb A G 10: 21,152,617 S116P probably damaging Het
Nf2 G A 11: 4,780,613 Q513* probably null Het
Nmnat3 C T 9: 98,410,152 T150M possibly damaging Het
Olfr361 C A 2: 37,084,930 V273F probably benign Het
Olfr743 T C 14: 50,533,759 C116R possibly damaging Het
Patj T G 4: 98,650,454 C210W possibly damaging Het
Pde3b A G 7: 114,416,287 H246R probably benign Het
Pnp2 A G 14: 50,959,625 H56R probably benign Het
Prkg1 A G 19: 30,569,229 probably benign Het
Rhbdf1 C T 11: 32,216,236 S8N probably damaging Het
Rimbp3 A G 16: 17,209,692 K327E possibly damaging Het
Rnf219 A G 14: 104,479,257 V560A probably benign Het
Rsph6a T A 7: 19,067,078 probably null Het
Ryr2 T C 13: 11,649,812 N3535S probably benign Het
Ssfa2 A G 2: 79,641,998 N132S probably benign Het
Ston1 T G 17: 88,637,008 V614G probably damaging Het
Svep1 T A 4: 58,138,695 T466S possibly damaging Het
Tas2r109 A T 6: 132,980,181 I262N probably benign Het
Tmtc1 T C 6: 148,355,098 probably benign Het
Tshz2 G A 2: 169,884,938 E16K possibly damaging Het
Ufsp2 T A 8: 45,985,465 S193R possibly damaging Het
Ugt2b5 C A 5: 87,139,763 E182* probably null Het
Usp43 A G 11: 67,891,464 V376A probably benign Het
Utp15 A T 13: 98,259,247 F76I possibly damaging Het
Wdr62 A C 7: 30,242,248 L1141R probably damaging Het
Zfp418 T A 7: 7,172,162 M18K probably benign Het
Other mutations in Col9a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Col9a3 APN 2 180616434 missense probably damaging 0.96
IGL01542:Col9a3 APN 2 180609316 splice site probably benign
IGL01727:Col9a3 APN 2 180616565 critical splice donor site probably null
IGL02558:Col9a3 APN 2 180606806 critical splice acceptor site probably null
IGL03112:Col9a3 APN 2 180607642 missense possibly damaging 0.60
IGL02796:Col9a3 UTSW 2 180614162 missense probably damaging 1.00
R0022:Col9a3 UTSW 2 180619756 missense probably damaging 1.00
R0022:Col9a3 UTSW 2 180619756 missense probably damaging 1.00
R0046:Col9a3 UTSW 2 180609487 missense possibly damaging 0.47
R0046:Col9a3 UTSW 2 180609487 missense possibly damaging 0.47
R0477:Col9a3 UTSW 2 180609470 splice site probably benign
R0890:Col9a3 UTSW 2 180610063 missense probably benign 0.23
R1934:Col9a3 UTSW 2 180607134 missense probably damaging 0.98
R4571:Col9a3 UTSW 2 180616366 splice site probably benign
R4688:Col9a3 UTSW 2 180607631 missense probably damaging 0.99
R4731:Col9a3 UTSW 2 180610681 missense probably damaging 0.99
R4742:Col9a3 UTSW 2 180603387 missense unknown
R4847:Col9a3 UTSW 2 180615525 missense probably damaging 1.00
R4985:Col9a3 UTSW 2 180603400 missense unknown
R5488:Col9a3 UTSW 2 180616525 missense probably damaging 1.00
R5489:Col9a3 UTSW 2 180616525 missense probably damaging 1.00
R5573:Col9a3 UTSW 2 180619732 missense probably benign 0.17
R5575:Col9a3 UTSW 2 180598846 intron probably benign
R6820:Col9a3 UTSW 2 180607134 missense probably damaging 0.98
R7114:Col9a3 UTSW 2 180603797 missense unknown
R7710:Col9a3 UTSW 2 180609365 missense probably damaging 0.98
R8177:Col9a3 UTSW 2 180607657 missense probably damaging 0.97
R8342:Col9a3 UTSW 2 180603390 missense unknown
R8472:Col9a3 UTSW 2 180605264 missense probably damaging 1.00
R8783:Col9a3 UTSW 2 180614177 missense probably damaging 0.98
R9683:Col9a3 UTSW 2 180606529 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAGGTCACCATAATTTAGGTTGCC -3'
(R):5'- AACGTGCCTGACATCAGCTG -3'

Sequencing Primer
(F):5'- GCCTTTTTACAGCTATAGGCAAG -3'
(R):5'- AACACTAGCCTTGGTGTCAG -3'
Posted On 2015-07-07