Mutagenetix > Incidental Mutation

Incidental Mutation 'R4355:Kirrel'

327474

Institutional Source

Beutler Lab

Gene Symbol

Kirrel

Ensembl Gene

ENSMUSG00000041734

Gene Name

kirre like nephrin family adhesion molecule 1

Synonyms

Kirrel1, 6720469N11Rik, Neph1

MMRRC Submission

041108-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4355 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87078593-87174747 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 87089151 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 380 (M380I)

Ref Sequence

ENSEMBL: ENSMUSP00000125525 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041732] [ENSMUST00000107618] [ENSMUST00000159976]

AlphaFold

Q80W68

Predicted Effect

probably null
Transcript: ENSMUST00000041732
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000043756
Gene: ENSMUSG00000041734
AA Change: M380I

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000107618
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000103243
Gene: ENSMUSG00000041734
AA Change: M380I

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC
low complexity region	694	712	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000159976
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000125525
Gene: ENSMUSG00000041734
AA Change: M380I

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC
low complexity region	694	712	N/A	INTRINSIC

Meta Mutation Damage Score

0.0922

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NEPH1 is a member of the nephrin-like protein family, which includes NEPH2 (MIM 607761) and NEPH3 (MIM 607762). The cytoplasmic domains of these proteins interact with the C terminus of podocin (NPHS2; MIM 604766), and the genes are expressed in kidney podocytes, cells involved in ensuring size- and charge-selective ultrafiltration (Sellin et al., 2003 [PubMed 12424224]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit postnatal lethality and are small and sickly. Glomerular and tubular defects in the kidney result in severe proteinuria. [provided by MGI curators]

Allele List at MGI

All alleles(121) : Targeted, other(2) Gene trapped(119)

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam26a	T	G	8: 43,570,185 (GRCm38)	Q89H	probably benign	Het
Adgrb1	T	C	15: 74,543,662 (GRCm38)	F697S	probably damaging	Het
Adgrl2	A	T	3: 148,839,152 (GRCm38)	V769E	probably damaging	Het
Aldh7a1	A	T	18: 56,548,494 (GRCm38)	F173L	probably null	Het
Arntl	A	G	7: 113,303,406 (GRCm38)	I421V	possibly damaging	Het
Bcl3	G	T	7: 19,811,580 (GRCm38)	C208*	probably null	Het
Casz1	T	C	4: 148,952,335 (GRCm38)	S1685P	unknown	Het
Cep250	A	G	2: 155,991,525 (GRCm38)	E1789G	probably damaging	Het
Cep76	A	T	18: 67,626,640 (GRCm38)	D334E	probably benign	Het
Clca3b	A	T	3: 144,825,458 (GRCm38)		probably null	Het
Col9a3	A	G	2: 180,606,478 (GRCm38)	S208G	probably benign	Het
Ddx47	T	C	6: 135,021,505 (GRCm38)	V388A	probably benign	Het
Dync1h1	C	T	12: 110,632,899 (GRCm38)	A1896V	possibly damaging	Het
Eif2ak2	T	A	17: 78,858,534 (GRCm38)	R411S	probably benign	Het
F7	A	G	8: 13,034,774 (GRCm38)	T267A	probably benign	Het
Fras1	C	A	5: 96,700,242 (GRCm38)	D1770E	probably benign	Het
G2e3	T	A	12: 51,365,337 (GRCm38)	Y387N	probably benign	Het
Hspg2	C	T	4: 137,529,418 (GRCm38)	L1491F	probably damaging	Het
Ighv3-4	T	C	12: 114,253,640 (GRCm38)	I110M	probably benign	Het
Itgb5	T	A	16: 33,844,997 (GRCm38)	C28S	probably damaging	Het
Kbtbd11	C	A	8: 15,028,578 (GRCm38)	N392K	probably damaging	Het
Kcnmb4	A	G	10: 116,473,284 (GRCm38)	S80P	possibly damaging	Het
Kif21a	C	T	15: 90,970,833 (GRCm38)	C721Y	probably benign	Het
Klrc3	T	C	6: 129,639,162 (GRCm38)	M189V	probably benign	Het
Macf1	T	A	4: 123,475,091 (GRCm38)	E394V	possibly damaging	Het
Mrgprb4	C	T	7: 48,198,701 (GRCm38)	G160R	possibly damaging	Het
Myb	A	G	10: 21,152,617 (GRCm38)	S116P	probably damaging	Het
Nf2	G	A	11: 4,780,613 (GRCm38)	Q513*	probably null	Het
Nmnat3	C	T	9: 98,410,152 (GRCm38)	T150M	possibly damaging	Het
Olfr361	C	A	2: 37,084,930 (GRCm38)	V273F	probably benign	Het
Olfr743	T	C	14: 50,533,759 (GRCm38)	C116R	possibly damaging	Het
Patj	T	G	4: 98,650,454 (GRCm38)	C210W	possibly damaging	Het
Pde3b	A	G	7: 114,416,287 (GRCm38)	H246R	probably benign	Het
Pnp2	A	G	14: 50,959,625 (GRCm38)	H56R	probably benign	Het
Prkg1	A	G	19: 30,569,229 (GRCm38)		probably benign	Het
Rhbdf1	C	T	11: 32,216,236 (GRCm38)	S8N	probably damaging	Het
Rimbp3	A	G	16: 17,209,692 (GRCm38)	K327E	possibly damaging	Het
Rnf219	A	G	14: 104,479,257 (GRCm38)	V560A	probably benign	Het
Rsph6a	T	A	7: 19,067,078 (GRCm38)		probably null	Het
Ryr2	T	C	13: 11,649,812 (GRCm38)	N3535S	probably benign	Het
Ssfa2	A	G	2: 79,641,998 (GRCm38)	N132S	probably benign	Het
Ston1	T	G	17: 88,637,008 (GRCm38)	V614G	probably damaging	Het
Svep1	T	A	4: 58,138,695 (GRCm38)	T466S	possibly damaging	Het
Tas2r109	A	T	6: 132,980,181 (GRCm38)	I262N	probably benign	Het
Tmtc1	T	C	6: 148,355,098 (GRCm38)		probably benign	Het
Tshz2	G	A	2: 169,884,938 (GRCm38)	E16K	possibly damaging	Het
Ufsp2	T	A	8: 45,985,465 (GRCm38)	S193R	possibly damaging	Het
Ugt2b5	C	A	5: 87,139,763 (GRCm38)	E182*	probably null	Het
Usp43	A	G	11: 67,891,464 (GRCm38)	V376A	probably benign	Het
Utp15	A	T	13: 98,259,247 (GRCm38)	F76I	possibly damaging	Het
Wdr62	A	C	7: 30,242,248 (GRCm38)	L1141R	probably damaging	Het
Zfp418	T	A	7: 7,172,162 (GRCm38)	M18K	probably benign	Het

Other mutations in Kirrel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Kirrel	APN	3	87,089,875 (GRCm38)	missense	probably benign	0.22
IGL01865:Kirrel	APN	3	87,086,424 (GRCm38)	missense	probably damaging	1.00
IGL01875:Kirrel	APN	3	87,095,730 (GRCm38)	missense	probably damaging	1.00
IGL02337:Kirrel	APN	3	87,089,212 (GRCm38)	missense	possibly damaging	0.64
IGL02724:Kirrel	APN	3	87,090,473 (GRCm38)	nonsense	probably null
IGL02825:Kirrel	APN	3	87,089,288 (GRCm38)	splice site	probably benign
IGL02826:Kirrel	APN	3	87,088,485 (GRCm38)	missense	probably damaging	1.00
IGL03102:Kirrel	APN	3	87,083,500 (GRCm38)	missense	probably damaging	0.98
D4043:Kirrel	UTSW	3	87,083,203 (GRCm38)	missense	probably benign	0.02
R0360:Kirrel	UTSW	3	87,089,799 (GRCm38)	missense	probably damaging	1.00
R0364:Kirrel	UTSW	3	87,089,799 (GRCm38)	missense	probably damaging	1.00
R0421:Kirrel	UTSW	3	87,083,607 (GRCm38)	missense	probably damaging	0.99
R0503:Kirrel	UTSW	3	87,097,802 (GRCm38)	missense	probably benign	0.20
R1112:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R1116:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R1144:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R1147:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R1147:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R1190:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R1226:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R1501:Kirrel	UTSW	3	87,090,472 (GRCm38)	missense	probably benign	0.02
R1538:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R1546:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R1628:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R1630:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R1631:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R1664:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R1671:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R1695:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R1769:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R1807:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R1808:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R1840:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R1876:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R1995:Kirrel	UTSW	3	87,095,786 (GRCm38)	missense	possibly damaging	0.88
R2014:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R2086:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R2108:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R2354:Kirrel	UTSW	3	87,088,485 (GRCm38)	missense	probably damaging	0.98
R2407:Kirrel	UTSW	3	87,084,843 (GRCm38)	missense	probably benign	0.03
R2904:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R2905:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R2958:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R2959:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R2960:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R2961:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R3026:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R3028:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R3034:Kirrel	UTSW	3	87,083,439 (GRCm38)	missense	possibly damaging	0.56
R3149:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R3195:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R3196:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R3499:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R3699:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R3720:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R3721:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R3788:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R3793:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R3876:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R3877:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R3901:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R3910:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R3911:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R3912:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R3913:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R3930:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R3931:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R4022:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R4067:Kirrel	UTSW	3	87,088,467 (GRCm38)	nonsense	probably null
R4077:Kirrel	UTSW	3	87,085,080 (GRCm38)	critical splice donor site	probably null
R4198:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R4328:Kirrel	UTSW	3	87,084,774 (GRCm38)	intron	probably benign
R4363:Kirrel	UTSW	3	87,090,485 (GRCm38)	nonsense	probably null
R4378:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R4386:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R4460:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R4468:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R4469:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R4650:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R4652:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R4734:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R4748:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R4749:Kirrel	UTSW	3	87,089,151 (GRCm38)	missense	probably null	0.46
R5304:Kirrel	UTSW	3	87,089,595 (GRCm38)	missense	probably benign	0.02
R5534:Kirrel	UTSW	3	87,090,518 (GRCm38)	missense	probably damaging	1.00
R5604:Kirrel	UTSW	3	87,089,155 (GRCm38)	missense	possibly damaging	0.69
R7199:Kirrel	UTSW	3	87,083,388 (GRCm38)	missense	probably benign	0.02
R7221:Kirrel	UTSW	3	87,086,397 (GRCm38)	nonsense	probably null
R7284:Kirrel	UTSW	3	87,083,387 (GRCm38)	missense	probably benign	0.02
R7332:Kirrel	UTSW	3	87,088,398 (GRCm38)	missense	probably benign	0.14
R7369:Kirrel	UTSW	3	87,141,084 (GRCm38)	missense	probably benign	0.20
R7371:Kirrel	UTSW	3	87,088,422 (GRCm38)	missense	probably benign	0.44
R7508:Kirrel	UTSW	3	87,083,439 (GRCm38)	missense	possibly damaging	0.56
R7566:Kirrel	UTSW	3	87,088,484 (GRCm38)	missense	probably damaging	1.00
R7567:Kirrel	UTSW	3	87,095,681 (GRCm38)	missense	probably damaging	0.99
R7621:Kirrel	UTSW	3	87,088,221 (GRCm38)	missense	possibly damaging	0.70
R8030:Kirrel	UTSW	3	87,097,775 (GRCm38)	missense	probably damaging	1.00
R8141:Kirrel	UTSW	3	87,086,428 (GRCm38)	nonsense	probably null
R8261:Kirrel	UTSW	3	87,088,002 (GRCm38)	intron	probably benign
R8477:Kirrel	UTSW	3	87,084,831 (GRCm38)	missense	possibly damaging	0.71
R8512:Kirrel	UTSW	3	87,088,227 (GRCm38)	missense	probably benign	0.00
R8954:Kirrel	UTSW	3	87,089,866 (GRCm38)	missense	probably benign	0.25
R8987:Kirrel	UTSW	3	87,085,093 (GRCm38)	missense	probably damaging	1.00
R9058:Kirrel	UTSW	3	87,085,135 (GRCm38)	missense	probably benign	0.18
R9146:Kirrel	UTSW	3	87,095,708 (GRCm38)	missense	probably damaging	1.00
R9311:Kirrel	UTSW	3	87,097,816 (GRCm38)	missense	probably benign	0.29
R9527:Kirrel	UTSW	3	87,089,605 (GRCm38)	nonsense	probably null
R9629:Kirrel	UTSW	3	87,095,718 (GRCm38)	nonsense	probably null
Z1177:Kirrel	UTSW	3	87,083,875 (GRCm38)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACCCTGAGTTCTATGCAAGTCC -3'
(R):5'- AGCTGATGATTCTCAGGCACC -3'

Sequencing Primer
(F):5'- TATGGCTGACTGCAAGTACC -3'
(R):5'- TCAGGCACCTGAGACTCTGAC -3'

Posted On

2015-07-07