Incidental Mutation 'R4355:Clca3b'
ID327475
Institutional Source Beutler Lab
Gene Symbol Clca3b
Ensembl Gene ENSMUSG00000037033
Gene Namechloride channel accessory 3B
SynonymsClca4
MMRRC Submission 041108-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R4355 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location144822623-144849357 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 144825458 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159989]
Predicted Effect probably null
Transcript: ENSMUST00000159989
SMART Domains Protein: ENSMUSP00000124581
Gene: ENSMUSG00000037033

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 481 6.22e-19 SMART
FN3 762 861 4.93e0 SMART
low complexity region 880 1025 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a T G 8: 43,570,185 Q89H probably benign Het
Adgrb1 T C 15: 74,543,662 F697S probably damaging Het
Adgrl2 A T 3: 148,839,152 V769E probably damaging Het
Aldh7a1 A T 18: 56,548,494 F173L probably null Het
Arntl A G 7: 113,303,406 I421V possibly damaging Het
Bcl3 G T 7: 19,811,580 C208* probably null Het
Casz1 T C 4: 148,952,335 S1685P unknown Het
Cep250 A G 2: 155,991,525 E1789G probably damaging Het
Cep76 A T 18: 67,626,640 D334E probably benign Het
Col9a3 A G 2: 180,606,478 S208G probably benign Het
Ddx47 T C 6: 135,021,505 V388A probably benign Het
Dync1h1 C T 12: 110,632,899 A1896V possibly damaging Het
Eif2ak2 T A 17: 78,858,534 R411S probably benign Het
F7 A G 8: 13,034,774 T267A probably benign Het
Fras1 C A 5: 96,700,242 D1770E probably benign Het
G2e3 T A 12: 51,365,337 Y387N probably benign Het
Hspg2 C T 4: 137,529,418 L1491F probably damaging Het
Ighv3-4 T C 12: 114,253,640 I110M probably benign Het
Itgb5 T A 16: 33,844,997 C28S probably damaging Het
Kbtbd11 C A 8: 15,028,578 N392K probably damaging Het
Kcnmb4 A G 10: 116,473,284 S80P possibly damaging Het
Kif21a C T 15: 90,970,833 C721Y probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klrc3 T C 6: 129,639,162 M189V probably benign Het
Macf1 T A 4: 123,475,091 E394V possibly damaging Het
Mrgprb4 C T 7: 48,198,701 G160R possibly damaging Het
Myb A G 10: 21,152,617 S116P probably damaging Het
Nf2 G A 11: 4,780,613 Q513* probably null Het
Nmnat3 C T 9: 98,410,152 T150M possibly damaging Het
Olfr361 C A 2: 37,084,930 V273F probably benign Het
Olfr743 T C 14: 50,533,759 C116R possibly damaging Het
Patj T G 4: 98,650,454 C210W possibly damaging Het
Pde3b A G 7: 114,416,287 H246R probably benign Het
Pnp2 A G 14: 50,959,625 H56R probably benign Het
Prkg1 A G 19: 30,569,229 probably benign Het
Rhbdf1 C T 11: 32,216,236 S8N probably damaging Het
Rimbp3 A G 16: 17,209,692 K327E possibly damaging Het
Rnf219 A G 14: 104,479,257 V560A probably benign Het
Rsph6a T A 7: 19,067,078 probably null Het
Ryr2 T C 13: 11,649,812 N3535S probably benign Het
Ssfa2 A G 2: 79,641,998 N132S probably benign Het
Ston1 T G 17: 88,637,008 V614G probably damaging Het
Svep1 T A 4: 58,138,695 T466S possibly damaging Het
Tas2r109 A T 6: 132,980,181 I262N probably benign Het
Tmtc1 T C 6: 148,355,098 probably benign Het
Tshz2 G A 2: 169,884,938 E16K possibly damaging Het
Ufsp2 T A 8: 45,985,465 S193R possibly damaging Het
Ugt2b5 C A 5: 87,139,763 E182* probably null Het
Usp43 A G 11: 67,891,464 V376A probably benign Het
Utp15 A T 13: 98,259,247 F76I possibly damaging Het
Wdr62 A C 7: 30,242,248 L1141R probably damaging Het
Zfp418 T A 7: 7,172,162 M18K probably benign Het
Other mutations in Clca3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Clca3b APN 3 144836632 missense probably damaging 0.96
IGL00425:Clca3b APN 3 144836581 missense probably benign 0.14
IGL00725:Clca3b APN 3 144839162 missense probably benign 0.01
IGL00898:Clca3b APN 3 144844628 splice site probably benign
IGL00953:Clca3b APN 3 144847211 nonsense probably null
IGL01089:Clca3b APN 3 144823522 missense probably benign
IGL01376:Clca3b APN 3 144826051 missense possibly damaging 0.60
IGL01996:Clca3b APN 3 144849163 missense probably benign 0.04
IGL02022:Clca3b APN 3 144841410 critical splice donor site probably null
IGL02200:Clca3b APN 3 144841429 missense probably damaging 1.00
IGL02314:Clca3b APN 3 144828142 splice site probably benign
IGL02331:Clca3b APN 3 144841406 splice site probably benign
IGL02429:Clca3b APN 3 144828135 missense probably damaging 1.00
IGL02868:Clca3b APN 3 144827564 missense probably damaging 1.00
IGL03095:Clca3b APN 3 144846910 nonsense probably null
IGL03331:Clca3b APN 3 144827963 missense probably benign
R0242:Clca3b UTSW 3 144841465 missense probably benign 0.00
R0242:Clca3b UTSW 3 144841465 missense probably benign 0.00
R0506:Clca3b UTSW 3 144822866 unclassified probably benign
R0524:Clca3b UTSW 3 144825321 missense probably benign
R0637:Clca3b UTSW 3 144827940 missense probably benign 0.03
R1577:Clca3b UTSW 3 144823519 missense probably damaging 1.00
R1641:Clca3b UTSW 3 144823513 missense possibly damaging 0.53
R1680:Clca3b UTSW 3 144837824 missense probably damaging 1.00
R2240:Clca3b UTSW 3 144825935 missense probably benign 0.22
R2248:Clca3b UTSW 3 144825219 missense probably benign 0.01
R2259:Clca3b UTSW 3 144846381 missense possibly damaging 0.80
R2920:Clca3b UTSW 3 144837853 missense probably benign 0.31
R2920:Clca3b UTSW 3 144846931 missense probably benign 0.01
R4691:Clca3b UTSW 3 144839092 missense probably benign 0.02
R4828:Clca3b UTSW 3 144844512 missense probably benign 0.02
R4845:Clca3b UTSW 3 144825270 missense probably benign
R5182:Clca3b UTSW 3 144828015 missense probably damaging 0.99
R5396:Clca3b UTSW 3 144847171 missense probably damaging 0.99
R5429:Clca3b UTSW 3 144846459 missense probably damaging 1.00
R5572:Clca3b UTSW 3 144827309 missense probably damaging 1.00
R5657:Clca3b UTSW 3 144827383 missense probably benign 0.25
R5845:Clca3b UTSW 3 144825316 missense possibly damaging 0.46
R6505:Clca3b UTSW 3 144825259 missense probably benign 0.18
R6677:Clca3b UTSW 3 144823384 missense probably benign 0.13
R6707:Clca3b UTSW 3 144844527 missense probably benign 0.00
R7001:Clca3b UTSW 3 144827972 missense possibly damaging 0.48
R7285:Clca3b UTSW 3 144837758 missense probably benign 0.00
R7323:Clca3b UTSW 3 144825920 missense possibly damaging 0.60
R7324:Clca3b UTSW 3 144841420 missense possibly damaging 0.81
R7334:Clca3b UTSW 3 144836656 nonsense probably null
R7403:Clca3b UTSW 3 144823498 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAACTCAGCCTCCAGGTCTG -3'
(R):5'- ACTCAGCATTGTCTATGAAGCAAG -3'

Sequencing Primer
(F):5'- AGCCTCCAGGTCTGTGACTTTAC -3'
(R):5'- TCTATGAAGCAAGCTCTGTGC -3'
Posted On2015-07-07