Incidental Mutation 'R0045:Kcnq4'
ID32748
Institutional Source Beutler Lab
Gene Symbol Kcnq4
Ensembl Gene ENSMUSG00000028631
Gene Namepotassium voltage-gated channel, subfamily Q, member 4
Synonyms
MMRRC Submission 038339-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.367) question?
Stock #R0045 (G1)
Quality Score94
Status Validated
Chromosome4
Chromosomal Location120696138-120748612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120697955 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 677 (D677V)
Ref Sequence ENSEMBL: ENSMUSP00000030376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030376]
Predicted Effect probably damaging
Transcript: ENSMUST00000030376
AA Change: D677V

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030376
Gene: ENSMUSG00000028631
AA Change: D677V

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 36 77 N/A INTRINSIC
Pfam:Ion_trans 99 331 1.2e-28 PFAM
Pfam:Ion_trans_2 244 324 5.4e-16 PFAM
Pfam:KCNQ_channel 465 655 1.6e-93 PFAM
Meta Mutation Damage Score 0.5389 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a potassium channel that is thought to play a critical role in the regulation of neuronal excitability, particularly in sensory cells of the cochlea. The current generated by this channel is inhibited by M1 muscarinic acetylcholine receptors and activated by retigabine, a novel anti-convulsant drug. The encoded protein can form a homomultimeric potassium channel or possibly a heteromultimeric channel in association with the protein encoded by the KCNQ3 gene. Defects in this gene are a cause of nonsyndromic sensorineural deafness type 2 (DFNA2), an autosomal dominant form of progressive hearing loss. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are either homozygous for a knock-out allele or homozygous for a dominant negative knock-in allele exhibit a slowly progressive hearing loss due to chronic depolarization and subsequent degeneration of cochlear outer hair cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,082,085 N299S probably damaging Het
Abi3 A G 11: 95,832,715 *368R probably null Het
Agbl1 T C 7: 76,698,840 probably null Het
Ap3b2 T C 7: 81,466,193 D650G possibly damaging Het
Arhgap30 A G 1: 171,408,430 S791G probably benign Het
Arvcf T A 16: 18,403,458 L722Q probably benign Het
Ascc3 C T 10: 50,718,402 R1198* probably null Het
Atf2 G T 2: 73,829,856 T189N probably benign Het
Atf7ip A G 6: 136,559,816 K16E probably damaging Het
Atg9b G T 5: 24,387,398 Q621K probably damaging Het
Atp12a G A 14: 56,372,873 E234K probably damaging Het
C8a T C 4: 104,826,815 K368E probably benign Het
Cdh23 T C 10: 60,530,978 Y241C probably damaging Het
Cdon G A 9: 35,486,807 S940N probably benign Het
Cds2 G T 2: 132,305,155 G402V possibly damaging Het
Cog6 T C 3: 52,992,750 probably null Het
Commd10 T C 18: 46,967,836 S114P possibly damaging Het
Dram2 T C 3: 106,570,817 V155A possibly damaging Het
Egr2 T A 10: 67,540,480 V252E probably benign Het
Exoc3l C T 8: 105,293,685 V203M probably damaging Het
Fsip1 C A 2: 118,248,292 probably null Het
Gm10840 C A 11: 106,161,100 probably benign Het
Gm8251 T C 1: 44,057,205 K1578E probably benign Het
Gpr37l1 A G 1: 135,161,145 L394P probably damaging Het
Gsap T C 5: 21,226,832 M243T possibly damaging Het
Hsd3b5 T A 3: 98,619,144 I329F probably benign Het
Htra1 T A 7: 130,961,532 S164R probably damaging Het
Il17b G A 18: 61,690,244 V50M probably damaging Het
Itga4 A T 2: 79,301,031 Y581F probably damaging Het
Jmjd8 A G 17: 25,829,281 E92G probably damaging Het
Klhl42 A G 6: 147,092,168 T213A probably benign Het
Lcn5 T C 2: 25,660,698 S133P probably damaging Het
Liph T C 16: 21,968,053 Y271C probably damaging Het
Lpcat3 T C 6: 124,701,474 I228T probably benign Het
Lrrd1 A G 5: 3,866,418 K812E possibly damaging Het
Ltbp2 G A 12: 84,809,587 T701I probably damaging Het
Ltbp2 T C 12: 84,813,288 T631A probably damaging Het
Mavs G A 2: 131,238,831 R13Q probably damaging Het
Mtor C G 4: 148,464,949 H597D probably benign Het
Muc5b T A 7: 141,856,818 H1309Q unknown Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Nnat A T 2: 157,560,488 probably benign Het
Olfr183 G A 16: 59,000,491 D269N probably benign Het
Olfr293 T C 7: 86,664,340 L226S possibly damaging Het
Olfr703 T A 7: 106,845,389 Y259* probably null Het
Olfr869 A T 9: 20,137,191 Q25L probably benign Het
Pclo C T 5: 14,539,471 A595V unknown Het
Pcsk6 T A 7: 65,962,928 C315S probably damaging Het
Pkd2 T A 5: 104,455,805 probably benign Het
Ppp2r3c T A 12: 55,293,821 I155F probably damaging Het
Rapgef4 A G 2: 72,198,778 H398R possibly damaging Het
Ripor2 A G 13: 24,694,226 D328G probably damaging Het
Rpgrip1 A T 14: 52,141,144 T509S possibly damaging Het
Sh3pxd2a A G 19: 47,267,183 I1032T probably damaging Het
Slc25a13 A T 6: 6,109,277 S362T probably benign Het
Stk35 A T 2: 129,800,568 R10* probably null Het
Tal1 A G 4: 115,068,565 D277G probably damaging Het
Tecta G A 9: 42,375,191 T723I probably damaging Het
Trp53bp1 A C 2: 121,204,497 V103G probably benign Het
Trpv4 A G 5: 114,636,457 S189P probably benign Het
Ttll5 T G 12: 85,879,359 probably benign Het
Usp8 A G 2: 126,742,223 T451A probably benign Het
Vac14 G A 8: 110,636,952 D340N probably benign Het
Vars C A 17: 34,998,066 A471S probably benign Het
Vars A T 17: 35,010,619 H404L probably damaging Het
Vmn2r70 T C 7: 85,566,044 N94S probably damaging Het
Vpreb2 T C 16: 17,980,767 L39P probably damaging Het
Vps13a A T 19: 16,640,810 L693* probably null Het
Wapl A G 14: 34,733,794 I176V probably benign Het
Wdr31 G T 4: 62,464,033 L4I possibly damaging Het
Other mutations in Kcnq4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Kcnq4 APN 4 120698016 nonsense probably null
IGL00225:Kcnq4 APN 4 120698016 nonsense probably null
IGL00228:Kcnq4 APN 4 120698016 nonsense probably null
IGL00310:Kcnq4 APN 4 120698016 nonsense probably null
IGL00330:Kcnq4 APN 4 120698016 nonsense probably null
IGL00333:Kcnq4 APN 4 120698016 nonsense probably null
IGL00335:Kcnq4 APN 4 120698016 nonsense probably null
IGL00336:Kcnq4 APN 4 120698016 nonsense probably null
IGL01143:Kcnq4 APN 4 120698623 missense probably damaging 1.00
IGL01373:Kcnq4 APN 4 120717032 missense probably damaging 1.00
IGL02095:Kcnq4 APN 4 120700027 splice site probably benign
IGL02335:Kcnq4 APN 4 120715854 missense probably damaging 1.00
IGL03188:Kcnq4 APN 4 120704426 missense possibly damaging 0.81
R0045:Kcnq4 UTSW 4 120697955 missense probably damaging 0.99
R0423:Kcnq4 UTSW 4 120717508 missense probably damaging 1.00
R0483:Kcnq4 UTSW 4 120716601 missense probably damaging 1.00
R0837:Kcnq4 UTSW 4 120746861 missense probably benign 0.00
R1722:Kcnq4 UTSW 4 120702427 missense probably benign 0.00
R1826:Kcnq4 UTSW 4 120704504 missense probably benign 0.00
R2059:Kcnq4 UTSW 4 120698002 missense probably benign 0.00
R4327:Kcnq4 UTSW 4 120711364 missense probably benign 0.00
R4690:Kcnq4 UTSW 4 120717011 missense probably damaging 0.99
R4706:Kcnq4 UTSW 4 120704486 missense probably benign
R4729:Kcnq4 UTSW 4 120713074 missense possibly damaging 0.47
R4806:Kcnq4 UTSW 4 120713094 missense probably damaging 1.00
R4859:Kcnq4 UTSW 4 120716613 missense probably damaging 1.00
R4885:Kcnq4 UTSW 4 120713063 missense probably benign 0.01
R5073:Kcnq4 UTSW 4 120717517 missense probably damaging 1.00
R5517:Kcnq4 UTSW 4 120715809 missense possibly damaging 0.66
R5590:Kcnq4 UTSW 4 120715885 missense probably damaging 0.98
R5653:Kcnq4 UTSW 4 120702411 missense probably benign 0.00
R5750:Kcnq4 UTSW 4 120715049 missense probably damaging 1.00
R6141:Kcnq4 UTSW 4 120715869 missense probably damaging 1.00
R6160:Kcnq4 UTSW 4 120716559 missense probably damaging 1.00
R7087:Kcnq4 UTSW 4 120704399 missense probably damaging 0.96
R7088:Kcnq4 UTSW 4 120704399 missense probably damaging 0.96
R7143:Kcnq4 UTSW 4 120711239 missense probably benign 0.05
R7225:Kcnq4 UTSW 4 120746914 missense probably benign 0.03
R7479:Kcnq4 UTSW 4 120715825 missense probably damaging 0.98
R7574:Kcnq4 UTSW 4 120711368 missense probably benign
R7879:Kcnq4 UTSW 4 120702435 missense probably benign 0.13
R7980:Kcnq4 UTSW 4 120711297 missense probably benign 0.02
X0020:Kcnq4 UTSW 4 120715327 missense probably damaging 1.00
Z1176:Kcnq4 UTSW 4 120698497 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCATAGCTAGAAGCTGGGTCAGG -3'
(R):5'- CCAGGTGCAGTCCATCGAACATAAG -3'

Sequencing Primer
(F):5'- AGCTCAATACTGCGTATGGC -3'
(R):5'- CGAACATAAGTTGGATCTGCTGC -3'
Posted On2013-05-09