Incidental Mutation 'R4355:Tas2r109'
ID 327484
Institutional Source Beutler Lab
Gene Symbol Tas2r109
Ensembl Gene ENSMUSG00000062528
Gene Name taste receptor, type 2, member 109
Synonyms mt2r62, T2R09, mGR09, Tas2r9
MMRRC Submission 041108-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R4355 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 132956978-132957928 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 132957144 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 262 (I262N)
Ref Sequence ENSEMBL: ENSMUSP00000069300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067539]
AlphaFold Q7M707
Predicted Effect probably benign
Transcript: ENSMUST00000067539
AA Change: I262N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000069300
Gene: ENSMUSG00000062528
AA Change: I262N

DomainStartEndE-ValueType
Pfam:TAS2R 9 309 4.3e-81 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a T G 8: 44,023,222 (GRCm39) Q89H probably benign Het
Adgrb1 T C 15: 74,415,511 (GRCm39) F697S probably damaging Het
Adgrl2 A T 3: 148,544,788 (GRCm39) V769E probably damaging Het
Aldh7a1 A T 18: 56,681,566 (GRCm39) F173L probably null Het
Bcl3 G T 7: 19,545,505 (GRCm39) C208* probably null Het
Bmal1 A G 7: 112,902,613 (GRCm39) I421V possibly damaging Het
Casz1 T C 4: 149,036,792 (GRCm39) S1685P unknown Het
Cep250 A G 2: 155,833,445 (GRCm39) E1789G probably damaging Het
Cep76 A T 18: 67,759,710 (GRCm39) D334E probably benign Het
Clca3b A T 3: 144,531,219 (GRCm39) probably null Het
Col9a3 A G 2: 180,248,271 (GRCm39) S208G probably benign Het
Ddx47 T C 6: 134,998,468 (GRCm39) V388A probably benign Het
Dync1h1 C T 12: 110,599,333 (GRCm39) A1896V possibly damaging Het
Eif2ak2 T A 17: 79,165,963 (GRCm39) R411S probably benign Het
F7 A G 8: 13,084,774 (GRCm39) T267A probably benign Het
Fras1 C A 5: 96,848,101 (GRCm39) D1770E probably benign Het
G2e3 T A 12: 51,412,120 (GRCm39) Y387N probably benign Het
Hspg2 C T 4: 137,256,729 (GRCm39) L1491F probably damaging Het
Ighv3-4 T C 12: 114,217,260 (GRCm39) I110M probably benign Het
Itgb5 T A 16: 33,665,367 (GRCm39) C28S probably damaging Het
Itprid2 A G 2: 79,472,342 (GRCm39) N132S probably benign Het
Kbtbd11 C A 8: 15,078,578 (GRCm39) N392K probably damaging Het
Kcnmb4 A G 10: 116,309,189 (GRCm39) S80P possibly damaging Het
Kif21a C T 15: 90,855,036 (GRCm39) C721Y probably benign Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Klrc3 T C 6: 129,616,125 (GRCm39) M189V probably benign Het
Macf1 T A 4: 123,368,884 (GRCm39) E394V possibly damaging Het
Mrgprb4 C T 7: 47,848,449 (GRCm39) G160R possibly damaging Het
Myb A G 10: 21,028,516 (GRCm39) S116P probably damaging Het
Nf2 G A 11: 4,730,613 (GRCm39) Q513* probably null Het
Nmnat3 C T 9: 98,292,205 (GRCm39) T150M possibly damaging Het
Obi1 A G 14: 104,716,693 (GRCm39) V560A probably benign Het
Or11g27 T C 14: 50,771,216 (GRCm39) C116R possibly damaging Het
Or12k8 C A 2: 36,974,942 (GRCm39) V273F probably benign Het
Patj T G 4: 98,538,691 (GRCm39) C210W possibly damaging Het
Pde3b A G 7: 114,015,522 (GRCm39) H246R probably benign Het
Pnp2 A G 14: 51,197,082 (GRCm39) H56R probably benign Het
Prkg1 A G 19: 30,546,629 (GRCm39) probably benign Het
Rhbdf1 C T 11: 32,166,236 (GRCm39) S8N probably damaging Het
Rimbp3 A G 16: 17,027,556 (GRCm39) K327E possibly damaging Het
Rsph6a T A 7: 18,801,003 (GRCm39) probably null Het
Ryr2 T C 13: 11,664,698 (GRCm39) N3535S probably benign Het
Ston1 T G 17: 88,944,436 (GRCm39) V614G probably damaging Het
Svep1 T A 4: 58,138,695 (GRCm39) T466S possibly damaging Het
Tmtc1 T C 6: 148,256,596 (GRCm39) probably benign Het
Tshz2 G A 2: 169,726,858 (GRCm39) E16K possibly damaging Het
Ufsp2 T A 8: 46,438,502 (GRCm39) S193R possibly damaging Het
Ugt2b5 C A 5: 87,287,622 (GRCm39) E182* probably null Het
Usp43 A G 11: 67,782,290 (GRCm39) V376A probably benign Het
Utp15 A T 13: 98,395,755 (GRCm39) F76I possibly damaging Het
Wdr62 A C 7: 29,941,673 (GRCm39) L1141R probably damaging Het
Zfp418 T A 7: 7,175,161 (GRCm39) M18K probably benign Het
Other mutations in Tas2r109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Tas2r109 APN 6 132,956,986 (GRCm39) missense probably benign 0.04
IGL01837:Tas2r109 APN 6 132,957,477 (GRCm39) missense probably benign 0.27
IGL02094:Tas2r109 APN 6 132,957,202 (GRCm39) missense possibly damaging 0.78
R0788:Tas2r109 UTSW 6 132,957,264 (GRCm39) missense probably benign 0.01
R0849:Tas2r109 UTSW 6 132,957,856 (GRCm39) missense probably benign 0.00
R1542:Tas2r109 UTSW 6 132,957,873 (GRCm39) missense possibly damaging 0.93
R1583:Tas2r109 UTSW 6 132,957,389 (GRCm39) missense probably benign 0.01
R2035:Tas2r109 UTSW 6 132,957,423 (GRCm39) missense probably benign
R3845:Tas2r109 UTSW 6 132,957,766 (GRCm39) missense probably damaging 0.99
R4060:Tas2r109 UTSW 6 132,957,148 (GRCm39) missense probably damaging 1.00
R5353:Tas2r109 UTSW 6 132,957,594 (GRCm39) missense possibly damaging 0.61
R5860:Tas2r109 UTSW 6 132,957,664 (GRCm39) missense probably benign 0.06
R6211:Tas2r109 UTSW 6 132,957,587 (GRCm39) nonsense probably null
R6378:Tas2r109 UTSW 6 132,957,844 (GRCm39) missense probably benign 0.00
R6861:Tas2r109 UTSW 6 132,957,048 (GRCm39) missense probably benign 0.43
R7319:Tas2r109 UTSW 6 132,957,663 (GRCm39) missense probably benign 0.33
R8553:Tas2r109 UTSW 6 132,957,171 (GRCm39) missense probably benign 0.33
R9447:Tas2r109 UTSW 6 132,957,270 (GRCm39) missense probably damaging 1.00
Z1088:Tas2r109 UTSW 6 132,957,264 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGATGAAATACATGCAGTCAAATTCT -3'
(R):5'- GAAGTCACATTATTTTCCTGTCTGT -3'

Sequencing Primer
(F):5'- GCTTCCTGTCTCTCAGAA -3'
(R):5'- CGTTGTTTTGTCCCTGTCAAC -3'
Posted On 2015-07-07