Mutagenetix > Incidental Mutation

Incidental Mutation 'R4355:Rsph6a'

327488

Institutional Source

Beutler Lab

Gene Symbol

Rsph6a

Ensembl Gene

ENSMUSG00000040866

Gene Name

radial spoke head 6 homolog A (Chlamydomonas)

Synonyms

RSP4, Rshl1

MMRRC Submission

041108-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

R4355 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

19054690-19074447 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 19067078 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000076153 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035521] [ENSMUST00000076887]

AlphaFold

Q8CDR2

Predicted Effect

probably null
Transcript: ENSMUST00000035521

SMART Domains

Protein: ENSMUSP00000046526
Gene: ENSMUSG00000040866

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
Pfam:Radial_spoke	191	685	2.3e-200	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000076887

SMART Domains

Protein: ENSMUSP00000076153
Gene: ENSMUSG00000040866

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
Pfam:Radial_spoke	188	287	3e-18	PFAM
Pfam:Radial_spoke	285	433	4.6e-53	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144991

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to a sea urchin radial spoke head protein. Radial spoke protein complexes form part of the axoneme of eukaryotic flagella and are located between the axoneme's outer ring of doublet microtubules and central pair of microtubules. In Chlamydomonas, radial spoke proteins are thought to regulate the activity of dynein and the symmetry of flagellar bending patterns. This gene maps to a region of chromosome 19 that is linked to primary ciliary dyskinesia-2 (CILD2). [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam26a	T	G	8: 43,570,185	Q89H	probably benign	Het
Adgrb1	T	C	15: 74,543,662	F697S	probably damaging	Het
Adgrl2	A	T	3: 148,839,152	V769E	probably damaging	Het
Aldh7a1	A	T	18: 56,548,494	F173L	probably null	Het
Arntl	A	G	7: 113,303,406	I421V	possibly damaging	Het
Bcl3	G	T	7: 19,811,580	C208*	probably null	Het
Casz1	T	C	4: 148,952,335	S1685P	unknown	Het
Cep250	A	G	2: 155,991,525	E1789G	probably damaging	Het
Cep76	A	T	18: 67,626,640	D334E	probably benign	Het
Clca3b	A	T	3: 144,825,458		probably null	Het
Col9a3	A	G	2: 180,606,478	S208G	probably benign	Het
Ddx47	T	C	6: 135,021,505	V388A	probably benign	Het
Dync1h1	C	T	12: 110,632,899	A1896V	possibly damaging	Het
Eif2ak2	T	A	17: 78,858,534	R411S	probably benign	Het
F7	A	G	8: 13,034,774	T267A	probably benign	Het
Fras1	C	A	5: 96,700,242	D1770E	probably benign	Het
G2e3	T	A	12: 51,365,337	Y387N	probably benign	Het
Hspg2	C	T	4: 137,529,418	L1491F	probably damaging	Het
Ighv3-4	T	C	12: 114,253,640	I110M	probably benign	Het
Itgb5	T	A	16: 33,844,997	C28S	probably damaging	Het
Kbtbd11	C	A	8: 15,028,578	N392K	probably damaging	Het
Kcnmb4	A	G	10: 116,473,284	S80P	possibly damaging	Het
Kif21a	C	T	15: 90,970,833	C721Y	probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Klrc3	T	C	6: 129,639,162	M189V	probably benign	Het
Macf1	T	A	4: 123,475,091	E394V	possibly damaging	Het
Mrgprb4	C	T	7: 48,198,701	G160R	possibly damaging	Het
Myb	A	G	10: 21,152,617	S116P	probably damaging	Het
Nf2	G	A	11: 4,780,613	Q513*	probably null	Het
Nmnat3	C	T	9: 98,410,152	T150M	possibly damaging	Het
Olfr361	C	A	2: 37,084,930	V273F	probably benign	Het
Olfr743	T	C	14: 50,533,759	C116R	possibly damaging	Het
Patj	T	G	4: 98,650,454	C210W	possibly damaging	Het
Pde3b	A	G	7: 114,416,287	H246R	probably benign	Het
Pnp2	A	G	14: 50,959,625	H56R	probably benign	Het
Prkg1	A	G	19: 30,569,229		probably benign	Het
Rhbdf1	C	T	11: 32,216,236	S8N	probably damaging	Het
Rimbp3	A	G	16: 17,209,692	K327E	possibly damaging	Het
Rnf219	A	G	14: 104,479,257	V560A	probably benign	Het
Ryr2	T	C	13: 11,649,812	N3535S	probably benign	Het
Ssfa2	A	G	2: 79,641,998	N132S	probably benign	Het
Ston1	T	G	17: 88,637,008	V614G	probably damaging	Het
Svep1	T	A	4: 58,138,695	T466S	possibly damaging	Het
Tas2r109	A	T	6: 132,980,181	I262N	probably benign	Het
Tmtc1	T	C	6: 148,355,098		probably benign	Het
Tshz2	G	A	2: 169,884,938	E16K	possibly damaging	Het
Ufsp2	T	A	8: 45,985,465	S193R	possibly damaging	Het
Ugt2b5	C	A	5: 87,139,763	E182*	probably null	Het
Usp43	A	G	11: 67,891,464	V376A	probably benign	Het
Utp15	A	T	13: 98,259,247	F76I	possibly damaging	Het
Wdr62	A	C	7: 30,242,248	L1141R	probably damaging	Het
Zfp418	T	A	7: 7,172,162	M18K	probably benign	Het

Other mutations in Rsph6a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01060:Rsph6a	APN	7	19054868	nonsense	probably null
IGL01656:Rsph6a	APN	7	19054845	missense	probably benign	0.00
IGL02997:Rsph6a	APN	7	19054839	missense	probably benign	0.32
R0396:Rsph6a	UTSW	7	19074106	missense	probably damaging	1.00
R0467:Rsph6a	UTSW	7	19057669	missense	possibly damaging	0.95
R0545:Rsph6a	UTSW	7	19054946	nonsense	probably null
R0603:Rsph6a	UTSW	7	19065961	missense	possibly damaging	0.66
R0848:Rsph6a	UTSW	7	19057670	missense	probably benign	0.07
R1943:Rsph6a	UTSW	7	19074076	missense	probably damaging	1.00
R2133:Rsph6a	UTSW	7	19068106	missense	probably damaging	1.00
R3713:Rsph6a	UTSW	7	19057550	missense	probably damaging	0.98
R3762:Rsph6a	UTSW	7	19055331	missense	probably damaging	1.00
R3826:Rsph6a	UTSW	7	19057614	missense	probably damaging	1.00
R3827:Rsph6a	UTSW	7	19057614	missense	probably damaging	1.00
R3828:Rsph6a	UTSW	7	19057614	missense	probably damaging	1.00
R4429:Rsph6a	UTSW	7	19074063	missense	probably damaging	1.00
R4524:Rsph6a	UTSW	7	19066045	missense	probably damaging	1.00
R4799:Rsph6a	UTSW	7	19065858	nonsense	probably null
R4896:Rsph6a	UTSW	7	19057740	missense	possibly damaging	0.67
R4906:Rsph6a	UTSW	7	19068072	missense	possibly damaging	0.92
R5004:Rsph6a	UTSW	7	19057740	missense	possibly damaging	0.67
R5637:Rsph6a	UTSW	7	19054895	missense	probably benign
R6066:Rsph6a	UTSW	7	19065815	missense	probably damaging	1.00
R7013:Rsph6a	UTSW	7	19054895	missense	probably benign
R7193:Rsph6a	UTSW	7	19065647	missense	probably damaging	1.00
R7689:Rsph6a	UTSW	7	19068037	missense	possibly damaging	0.64
R8170:Rsph6a	UTSW	7	19057580	missense	probably damaging	1.00
R8177:Rsph6a	UTSW	7	19074239	missense	unknown
R8956:Rsph6a	UTSW	7	19065439	intron	probably benign
R9032:Rsph6a	UTSW	7	19065325	missense	probably damaging	1.00
R9085:Rsph6a	UTSW	7	19065325	missense	probably damaging	1.00
R9222:Rsph6a	UTSW	7	19068061	missense	possibly damaging	0.88
R9529:Rsph6a	UTSW	7	19065610	missense	probably benign	0.15
R9654:Rsph6a	UTSW	7	19065407	missense	probably damaging	0.99
R9672:Rsph6a	UTSW	7	19065917	missense	probably damaging	1.00
Z1177:Rsph6a	UTSW	7	19065931	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CAACAATGTGTCCAGTCATAGAAG -3'
(R):5'- CATCAGTGCTTCCAGGTGTG -3'

Sequencing Primer
(F):5'- TCCAGTCATAGAAGCTGCTG -3'
(R):5'- CGCCTGCCCAGATAGGAAG -3'

Posted On

2015-07-07