Incidental Mutation 'R4355:Bcl3'
ID 327489
Institutional Source Beutler Lab
Gene Symbol Bcl3
Ensembl Gene ENSMUSG00000053175
Gene Name B cell leukemia/lymphoma 3
Synonyms Bcl-3
MMRRC Submission 041108-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4355 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 19808462-19822770 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 19811580 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 208 (C208*)
Ref Sequence ENSEMBL: ENSMUSP00000113851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120537] [ENSMUST00000135609]
AlphaFold Q9Z2F6
Predicted Effect probably null
Transcript: ENSMUST00000120537
AA Change: C208*
SMART Domains Protein: ENSMUSP00000113851
Gene: ENSMUSG00000053175
AA Change: C208*

DomainStartEndE-ValueType
ANK 129 162 4.01e0 SMART
ANK 166 195 4.43e-2 SMART
ANK 199 230 8.99e-3 SMART
ANK 236 265 3.23e-4 SMART
ANK 270 299 5.79e-6 SMART
ANK 303 332 1.4e1 SMART
low complexity region 377 402 N/A INTRINSIC
low complexity region 425 447 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128181
Predicted Effect probably benign
Transcript: ENSMUST00000135609
SMART Domains Protein: ENSMUSP00000117754
Gene: ENSMUSG00000053175

DomainStartEndE-ValueType
Pfam:Ank_5 1 52 7.2e-7 PFAM
low complexity region 85 94 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137373
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139680
SMART Domains Protein: ENSMUSP00000116129
Gene: ENSMUSG00000053175

DomainStartEndE-ValueType
ANK 66 99 4.01e0 SMART
ANK 103 132 4.43e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152768
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a proto-oncogene candidate. It is identified by its translocation into the immunoglobulin alpha-locus in some cases of B-cell leukemia. The protein encoded by this gene contains seven ankyrin repeats, which are most closely related to those found in I kappa B proteins. This protein functions as a transcriptional co-activator that activates through its association with NF-kappa B homodimers. The expression of this gene can be induced by NF-kappa B, which forms a part of the autoregulatory loop that controls the nuclear residence of p50 NF-kappa B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice lacking functional copies of this gene exhibit defects of the immune system including disruption of the humoral immune response and abnormal spleen and Peyer's patch organogenesis. Mutant mice show increased susceptibility to pathogens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a T G 8: 43,570,185 Q89H probably benign Het
Adgrb1 T C 15: 74,543,662 F697S probably damaging Het
Adgrl2 A T 3: 148,839,152 V769E probably damaging Het
Aldh7a1 A T 18: 56,548,494 F173L probably null Het
Arntl A G 7: 113,303,406 I421V possibly damaging Het
Casz1 T C 4: 148,952,335 S1685P unknown Het
Cep250 A G 2: 155,991,525 E1789G probably damaging Het
Cep76 A T 18: 67,626,640 D334E probably benign Het
Clca3b A T 3: 144,825,458 probably null Het
Col9a3 A G 2: 180,606,478 S208G probably benign Het
Ddx47 T C 6: 135,021,505 V388A probably benign Het
Dync1h1 C T 12: 110,632,899 A1896V possibly damaging Het
Eif2ak2 T A 17: 78,858,534 R411S probably benign Het
F7 A G 8: 13,034,774 T267A probably benign Het
Fras1 C A 5: 96,700,242 D1770E probably benign Het
G2e3 T A 12: 51,365,337 Y387N probably benign Het
Hspg2 C T 4: 137,529,418 L1491F probably damaging Het
Ighv3-4 T C 12: 114,253,640 I110M probably benign Het
Itgb5 T A 16: 33,844,997 C28S probably damaging Het
Kbtbd11 C A 8: 15,028,578 N392K probably damaging Het
Kcnmb4 A G 10: 116,473,284 S80P possibly damaging Het
Kif21a C T 15: 90,970,833 C721Y probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klrc3 T C 6: 129,639,162 M189V probably benign Het
Macf1 T A 4: 123,475,091 E394V possibly damaging Het
Mrgprb4 C T 7: 48,198,701 G160R possibly damaging Het
Myb A G 10: 21,152,617 S116P probably damaging Het
Nf2 G A 11: 4,780,613 Q513* probably null Het
Nmnat3 C T 9: 98,410,152 T150M possibly damaging Het
Olfr361 C A 2: 37,084,930 V273F probably benign Het
Olfr743 T C 14: 50,533,759 C116R possibly damaging Het
Patj T G 4: 98,650,454 C210W possibly damaging Het
Pde3b A G 7: 114,416,287 H246R probably benign Het
Pnp2 A G 14: 50,959,625 H56R probably benign Het
Prkg1 A G 19: 30,569,229 probably benign Het
Rhbdf1 C T 11: 32,216,236 S8N probably damaging Het
Rimbp3 A G 16: 17,209,692 K327E possibly damaging Het
Rnf219 A G 14: 104,479,257 V560A probably benign Het
Rsph6a T A 7: 19,067,078 probably null Het
Ryr2 T C 13: 11,649,812 N3535S probably benign Het
Ssfa2 A G 2: 79,641,998 N132S probably benign Het
Ston1 T G 17: 88,637,008 V614G probably damaging Het
Svep1 T A 4: 58,138,695 T466S possibly damaging Het
Tas2r109 A T 6: 132,980,181 I262N probably benign Het
Tmtc1 T C 6: 148,355,098 probably benign Het
Tshz2 G A 2: 169,884,938 E16K possibly damaging Het
Ufsp2 T A 8: 45,985,465 S193R possibly damaging Het
Ugt2b5 C A 5: 87,139,763 E182* probably null Het
Usp43 A G 11: 67,891,464 V376A probably benign Het
Utp15 A T 13: 98,259,247 F76I possibly damaging Het
Wdr62 A C 7: 30,242,248 L1141R probably damaging Het
Zfp418 T A 7: 7,172,162 M18K probably benign Het
Other mutations in Bcl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Bcl3 APN 7 19809614 missense probably damaging 1.00
IGL01669:Bcl3 APN 7 19812491 nonsense probably null
IGL03024:Bcl3 APN 7 19809134 splice site probably benign
Memorial UTSW 7 19812484 missense probably damaging 1.00
sunrise UTSW 7 19811580 nonsense probably null
sunrise2 UTSW 7 19809634 nonsense probably null
R0124:Bcl3 UTSW 7 19809651 missense probably damaging 1.00
R0136:Bcl3 UTSW 7 19809569 missense probably damaging 1.00
R0554:Bcl3 UTSW 7 19820066 missense probably benign 0.26
R1845:Bcl3 UTSW 7 19809627 missense probably damaging 0.98
R2571:Bcl3 UTSW 7 19809527 missense probably damaging 1.00
R4597:Bcl3 UTSW 7 19812503 missense probably damaging 0.97
R4993:Bcl3 UTSW 7 19820177 missense probably benign 0.00
R5587:Bcl3 UTSW 7 19809634 nonsense probably null
R6232:Bcl3 UTSW 7 19812484 missense probably damaging 1.00
R7439:Bcl3 UTSW 7 19822611 missense probably benign
R7565:Bcl3 UTSW 7 19812494 missense probably damaging 1.00
R8443:Bcl3 UTSW 7 19820157 missense probably benign 0.01
R9105:Bcl3 UTSW 7 19809250 missense probably damaging 1.00
R9500:Bcl3 UTSW 7 19822677 start codon destroyed probably null 0.14
R9540:Bcl3 UTSW 7 19822520 missense probably benign 0.09
RF022:Bcl3 UTSW 7 19809041 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAGTGAGCCCTTGAAGAAG -3'
(R):5'- TGACTCTCTTGAATCGGGAGAG -3'

Sequencing Primer
(F):5'- GGGGAAGCCACAGTCAGTC -3'
(R):5'- TCCCTAGATTCAAAAAGCCTGAGGTG -3'
Posted On 2015-07-07