Incidental Mutation 'R4355:Mrgprb4'
ID 327491
Institutional Source Beutler Lab
Gene Symbol Mrgprb4
Ensembl Gene ENSMUSG00000070550
Gene Name MAS-related GPR, member B4
Synonyms MrgB4
MMRRC Submission 041108-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4355 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 48198070-48199288 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 48198701 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 160 (G160R)
Ref Sequence ENSEMBL: ENSMUSP00000091952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094388]
AlphaFold Q91ZC0
Predicted Effect possibly damaging
Transcript: ENSMUST00000094388
AA Change: G160R

PolyPhen 2 Score 0.627 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000091952
Gene: ENSMUSG00000070550
AA Change: G160R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 37 215 6.4e-8 PFAM
Pfam:7tm_1 46 274 7.6e-12 PFAM
Meta Mutation Damage Score 0.3483 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (57/57)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable, fertile and overtly normal with no apparent alterations in the pattern of axonal innervation of the epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a T G 8: 43,570,185 Q89H probably benign Het
Adgrb1 T C 15: 74,543,662 F697S probably damaging Het
Adgrl2 A T 3: 148,839,152 V769E probably damaging Het
Aldh7a1 A T 18: 56,548,494 F173L probably null Het
Arntl A G 7: 113,303,406 I421V possibly damaging Het
Bcl3 G T 7: 19,811,580 C208* probably null Het
Casz1 T C 4: 148,952,335 S1685P unknown Het
Cep250 A G 2: 155,991,525 E1789G probably damaging Het
Cep76 A T 18: 67,626,640 D334E probably benign Het
Clca3b A T 3: 144,825,458 probably null Het
Col9a3 A G 2: 180,606,478 S208G probably benign Het
Ddx47 T C 6: 135,021,505 V388A probably benign Het
Dync1h1 C T 12: 110,632,899 A1896V possibly damaging Het
Eif2ak2 T A 17: 78,858,534 R411S probably benign Het
F7 A G 8: 13,034,774 T267A probably benign Het
Fras1 C A 5: 96,700,242 D1770E probably benign Het
G2e3 T A 12: 51,365,337 Y387N probably benign Het
Hspg2 C T 4: 137,529,418 L1491F probably damaging Het
Ighv3-4 T C 12: 114,253,640 I110M probably benign Het
Itgb5 T A 16: 33,844,997 C28S probably damaging Het
Kbtbd11 C A 8: 15,028,578 N392K probably damaging Het
Kcnmb4 A G 10: 116,473,284 S80P possibly damaging Het
Kif21a C T 15: 90,970,833 C721Y probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klrc3 T C 6: 129,639,162 M189V probably benign Het
Macf1 T A 4: 123,475,091 E394V possibly damaging Het
Myb A G 10: 21,152,617 S116P probably damaging Het
Nf2 G A 11: 4,780,613 Q513* probably null Het
Nmnat3 C T 9: 98,410,152 T150M possibly damaging Het
Olfr361 C A 2: 37,084,930 V273F probably benign Het
Olfr743 T C 14: 50,533,759 C116R possibly damaging Het
Patj T G 4: 98,650,454 C210W possibly damaging Het
Pde3b A G 7: 114,416,287 H246R probably benign Het
Pnp2 A G 14: 50,959,625 H56R probably benign Het
Prkg1 A G 19: 30,569,229 probably benign Het
Rhbdf1 C T 11: 32,216,236 S8N probably damaging Het
Rimbp3 A G 16: 17,209,692 K327E possibly damaging Het
Rnf219 A G 14: 104,479,257 V560A probably benign Het
Rsph6a T A 7: 19,067,078 probably null Het
Ryr2 T C 13: 11,649,812 N3535S probably benign Het
Ssfa2 A G 2: 79,641,998 N132S probably benign Het
Ston1 T G 17: 88,637,008 V614G probably damaging Het
Svep1 T A 4: 58,138,695 T466S possibly damaging Het
Tas2r109 A T 6: 132,980,181 I262N probably benign Het
Tmtc1 T C 6: 148,355,098 probably benign Het
Tshz2 G A 2: 169,884,938 E16K possibly damaging Het
Ufsp2 T A 8: 45,985,465 S193R possibly damaging Het
Ugt2b5 C A 5: 87,139,763 E182* probably null Het
Usp43 A G 11: 67,891,464 V376A probably benign Het
Utp15 A T 13: 98,259,247 F76I possibly damaging Het
Wdr62 A C 7: 30,242,248 L1141R probably damaging Het
Zfp418 T A 7: 7,172,162 M18K probably benign Het
Other mutations in Mrgprb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Mrgprb4 APN 7 48198901 missense probably benign
IGL02745:Mrgprb4 APN 7 48198358 missense probably damaging 0.97
R0718:Mrgprb4 UTSW 7 48198553 missense probably benign 0.10
R0849:Mrgprb4 UTSW 7 48199120 missense probably benign 0.24
R1526:Mrgprb4 UTSW 7 48198411 nonsense probably null
R2857:Mrgprb4 UTSW 7 48198336 missense possibly damaging 0.91
R2859:Mrgprb4 UTSW 7 48198336 missense possibly damaging 0.91
R5354:Mrgprb4 UTSW 7 48198329 missense probably benign 0.07
R5636:Mrgprb4 UTSW 7 48198470 missense probably benign 0.02
R5715:Mrgprb4 UTSW 7 48199039 missense probably damaging 1.00
R6180:Mrgprb4 UTSW 7 48198826 missense probably damaging 1.00
R6277:Mrgprb4 UTSW 7 48198901 missense probably benign
R7092:Mrgprb4 UTSW 7 48198236 missense probably benign 0.01
R7301:Mrgprb4 UTSW 7 48198758 missense probably damaging 0.99
R7779:Mrgprb4 UTSW 7 48199147 missense probably benign 0.19
R8077:Mrgprb4 UTSW 7 48198455 missense probably benign 0.00
R8292:Mrgprb4 UTSW 7 48198806 missense probably damaging 1.00
R8429:Mrgprb4 UTSW 7 48198425 missense probably benign 0.01
R9000:Mrgprb4 UTSW 7 48199021 missense probably damaging 1.00
R9006:Mrgprb4 UTSW 7 48198595 missense probably benign 0.12
R9106:Mrgprb4 UTSW 7 48198931 missense probably benign 0.43
Z1088:Mrgprb4 UTSW 7 48198682 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GTCACAAAGAACCTGGTCACAG -3'
(R):5'- CACTCAAGTTGTGCATTCCC -3'

Sequencing Primer
(F):5'- AGGAATCCTGTGTGACCCC -3'
(R):5'- CGCTGCCTATCTGTTATG -3'
Posted On 2015-07-07