Incidental Mutation 'R4355:Ufsp2'
ID327499
Institutional Source Beutler Lab
Gene Symbol Ufsp2
Ensembl Gene ENSMUSG00000031634
Gene NameUFM1-specific peptidase 2
Synonyms
MMRRC Submission 041108-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4355 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location45975528-45996958 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45985465 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 193 (S193R)
Ref Sequence ENSEMBL: ENSMUSP00000147993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034051] [ENSMUST00000123307] [ENSMUST00000130412] [ENSMUST00000209443] [ENSMUST00000210081]
Predicted Effect probably benign
Transcript: ENSMUST00000034051
AA Change: S268R

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000034051
Gene: ENSMUSG00000031634
AA Change: S268R

DomainStartEndE-ValueType
low complexity region 87 103 N/A INTRINSIC
Pfam:Peptidase_C78 268 453 1.3e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123041
Predicted Effect probably benign
Transcript: ENSMUST00000123307
Predicted Effect probably benign
Transcript: ENSMUST00000130412
Predicted Effect possibly damaging
Transcript: ENSMUST00000209443
AA Change: S193R

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000210081
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved cysteine protease. The protein cleaves two C-terminal residues from ubiquitin-fold modifier 1, a ubiquitin-like post-translational modifier protein. Activation of ubiquitin-fold modifier 1 by the encoded protein exposes a C-terminal glycine residue that allows interaction with other proteins and transfer to its target protein. An allelic variant of this gene has been associated with Beukes hip dysplasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a T G 8: 43,570,185 Q89H probably benign Het
Adgrb1 T C 15: 74,543,662 F697S probably damaging Het
Adgrl2 A T 3: 148,839,152 V769E probably damaging Het
Aldh7a1 A T 18: 56,548,494 F173L probably null Het
Arntl A G 7: 113,303,406 I421V possibly damaging Het
Bcl3 G T 7: 19,811,580 C208* probably null Het
Casz1 T C 4: 148,952,335 S1685P unknown Het
Cep250 A G 2: 155,991,525 E1789G probably damaging Het
Cep76 A T 18: 67,626,640 D334E probably benign Het
Clca3b A T 3: 144,825,458 probably null Het
Col9a3 A G 2: 180,606,478 S208G probably benign Het
Ddx47 T C 6: 135,021,505 V388A probably benign Het
Dync1h1 C T 12: 110,632,899 A1896V possibly damaging Het
Eif2ak2 T A 17: 78,858,534 R411S probably benign Het
F7 A G 8: 13,034,774 T267A probably benign Het
Fras1 C A 5: 96,700,242 D1770E probably benign Het
G2e3 T A 12: 51,365,337 Y387N probably benign Het
Hspg2 C T 4: 137,529,418 L1491F probably damaging Het
Ighv3-4 T C 12: 114,253,640 I110M probably benign Het
Itgb5 T A 16: 33,844,997 C28S probably damaging Het
Kbtbd11 C A 8: 15,028,578 N392K probably damaging Het
Kcnmb4 A G 10: 116,473,284 S80P possibly damaging Het
Kif21a C T 15: 90,970,833 C721Y probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klrc3 T C 6: 129,639,162 M189V probably benign Het
Macf1 T A 4: 123,475,091 E394V possibly damaging Het
Mrgprb4 C T 7: 48,198,701 G160R possibly damaging Het
Myb A G 10: 21,152,617 S116P probably damaging Het
Nf2 G A 11: 4,780,613 Q513* probably null Het
Nmnat3 C T 9: 98,410,152 T150M possibly damaging Het
Olfr361 C A 2: 37,084,930 V273F probably benign Het
Olfr743 T C 14: 50,533,759 C116R possibly damaging Het
Patj T G 4: 98,650,454 C210W possibly damaging Het
Pde3b A G 7: 114,416,287 H246R probably benign Het
Pnp2 A G 14: 50,959,625 H56R probably benign Het
Prkg1 A G 19: 30,569,229 probably benign Het
Rhbdf1 C T 11: 32,216,236 S8N probably damaging Het
Rimbp3 A G 16: 17,209,692 K327E possibly damaging Het
Rnf219 A G 14: 104,479,257 V560A probably benign Het
Rsph6a T A 7: 19,067,078 probably null Het
Ryr2 T C 13: 11,649,812 N3535S probably benign Het
Ssfa2 A G 2: 79,641,998 N132S probably benign Het
Ston1 T G 17: 88,637,008 V614G probably damaging Het
Svep1 T A 4: 58,138,695 T466S possibly damaging Het
Tas2r109 A T 6: 132,980,181 I262N probably benign Het
Tmtc1 T C 6: 148,355,098 probably benign Het
Tshz2 G A 2: 169,884,938 E16K possibly damaging Het
Ugt2b5 C A 5: 87,139,763 E182* probably null Het
Usp43 A G 11: 67,891,464 V376A probably benign Het
Utp15 A T 13: 98,259,247 F76I possibly damaging Het
Wdr62 A C 7: 30,242,248 L1141R probably damaging Het
Zfp418 T A 7: 7,172,162 M18K probably benign Het
Other mutations in Ufsp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02092:Ufsp2 APN 8 45995664 critical splice donor site probably null
IGL02122:Ufsp2 APN 8 45995648 missense probably benign 0.01
IGL02523:Ufsp2 APN 8 45983548 missense probably damaging 1.00
IGL03031:Ufsp2 APN 8 45984100 missense probably damaging 1.00
R0317:Ufsp2 UTSW 8 45992233 critical splice donor site probably null
R0523:Ufsp2 UTSW 8 45996743 missense probably benign 0.00
R0538:Ufsp2 UTSW 8 45992150 missense probably damaging 1.00
R0661:Ufsp2 UTSW 8 45979233 start codon destroyed probably null 1.00
R3927:Ufsp2 UTSW 8 45983686 splice site probably null
R4319:Ufsp2 UTSW 8 45995627 missense possibly damaging 0.95
R5183:Ufsp2 UTSW 8 45994089 missense probably benign 0.18
R5473:Ufsp2 UTSW 8 45992221 missense probably damaging 1.00
R6726:Ufsp2 UTSW 8 45985467 missense probably benign 0.05
R7133:Ufsp2 UTSW 8 45983624 missense probably benign 0.00
R7534:Ufsp2 UTSW 8 45980324 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- CCATTGACCTTAATGAATGAAGTCTT -3'
(R):5'- ACCCACTAATTACACCTATCTTAAATG -3'

Sequencing Primer
(F):5'- ATCTGCCTCATGACAGAC -3'
(R):5'- ACTTGCTACGTAGACCAGGTTGAC -3'
Posted On2015-07-07