Incidental Mutation 'R0045:Lrrd1'
ID32750
Institutional Source Beutler Lab
Gene Symbol Lrrd1
Ensembl Gene ENSMUSG00000040367
Gene Nameleucine rich repeats and death domain containing 1
Synonyms4932412H11Rik
MMRRC Submission 038339-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R0045 (G1)
Quality Score166
Status Validated
Chromosome5
Chromosomal Location3845173-3866596 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3866418 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 812 (K812E)
Ref Sequence ENSEMBL: ENSMUSP00000038675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044039]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044039
AA Change: K812E

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000038675
Gene: ENSMUSG00000040367
AA Change: K812E

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
LRR 181 203 3.18e1 SMART
LRR 204 226 7.8e1 SMART
LRR 227 249 5.26e0 SMART
LRR 250 272 3.98e1 SMART
LRR 273 294 2.33e1 SMART
LRR 296 318 2.14e1 SMART
LRR_TYP 319 342 1.45e-2 SMART
LRR 365 388 4.44e0 SMART
LRR 389 410 2.76e1 SMART
LRR 411 433 8.73e1 SMART
LRR 434 457 3.55e1 SMART
LRR 480 503 1.45e1 SMART
LRR 526 548 1.31e0 SMART
LRR 549 571 3.65e1 SMART
LRR 572 594 6.22e0 SMART
LRR 595 618 2.68e1 SMART
LRR 644 665 1.15e1 SMART
LRR 667 689 8.01e0 SMART
LRR 690 713 1.53e-1 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,082,085 N299S probably damaging Het
Abi3 A G 11: 95,832,715 *368R probably null Het
Agbl1 T C 7: 76,698,840 probably null Het
Ap3b2 T C 7: 81,466,193 D650G possibly damaging Het
Arhgap30 A G 1: 171,408,430 S791G probably benign Het
Arvcf T A 16: 18,403,458 L722Q probably benign Het
Ascc3 C T 10: 50,718,402 R1198* probably null Het
Atf2 G T 2: 73,829,856 T189N probably benign Het
Atf7ip A G 6: 136,559,816 K16E probably damaging Het
Atg9b G T 5: 24,387,398 Q621K probably damaging Het
Atp12a G A 14: 56,372,873 E234K probably damaging Het
C8a T C 4: 104,826,815 K368E probably benign Het
Cdh23 T C 10: 60,530,978 Y241C probably damaging Het
Cdon G A 9: 35,486,807 S940N probably benign Het
Cds2 G T 2: 132,305,155 G402V possibly damaging Het
Cog6 T C 3: 52,992,750 probably null Het
Commd10 T C 18: 46,967,836 S114P possibly damaging Het
Dram2 T C 3: 106,570,817 V155A possibly damaging Het
Egr2 T A 10: 67,540,480 V252E probably benign Het
Exoc3l C T 8: 105,293,685 V203M probably damaging Het
Fsip1 C A 2: 118,248,292 probably null Het
Gm10840 C A 11: 106,161,100 probably benign Het
Gm8251 T C 1: 44,057,205 K1578E probably benign Het
Gpr37l1 A G 1: 135,161,145 L394P probably damaging Het
Gsap T C 5: 21,226,832 M243T possibly damaging Het
Hsd3b5 T A 3: 98,619,144 I329F probably benign Het
Htra1 T A 7: 130,961,532 S164R probably damaging Het
Il17b G A 18: 61,690,244 V50M probably damaging Het
Itga4 A T 2: 79,301,031 Y581F probably damaging Het
Jmjd8 A G 17: 25,829,281 E92G probably damaging Het
Kcnq4 T A 4: 120,697,955 D677V probably damaging Het
Klhl42 A G 6: 147,092,168 T213A probably benign Het
Lcn5 T C 2: 25,660,698 S133P probably damaging Het
Liph T C 16: 21,968,053 Y271C probably damaging Het
Lpcat3 T C 6: 124,701,474 I228T probably benign Het
Ltbp2 G A 12: 84,809,587 T701I probably damaging Het
Ltbp2 T C 12: 84,813,288 T631A probably damaging Het
Mavs G A 2: 131,238,831 R13Q probably damaging Het
Mtor C G 4: 148,464,949 H597D probably benign Het
Muc5b T A 7: 141,856,818 H1309Q unknown Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Nnat A T 2: 157,560,488 probably benign Het
Olfr183 G A 16: 59,000,491 D269N probably benign Het
Olfr293 T C 7: 86,664,340 L226S possibly damaging Het
Olfr703 T A 7: 106,845,389 Y259* probably null Het
Olfr869 A T 9: 20,137,191 Q25L probably benign Het
Pclo C T 5: 14,539,471 A595V unknown Het
Pcsk6 T A 7: 65,962,928 C315S probably damaging Het
Pkd2 T A 5: 104,455,805 probably benign Het
Ppp2r3c T A 12: 55,293,821 I155F probably damaging Het
Rapgef4 A G 2: 72,198,778 H398R possibly damaging Het
Ripor2 A G 13: 24,694,226 D328G probably damaging Het
Rpgrip1 A T 14: 52,141,144 T509S possibly damaging Het
Sh3pxd2a A G 19: 47,267,183 I1032T probably damaging Het
Slc25a13 A T 6: 6,109,277 S362T probably benign Het
Stk35 A T 2: 129,800,568 R10* probably null Het
Tal1 A G 4: 115,068,565 D277G probably damaging Het
Tecta G A 9: 42,375,191 T723I probably damaging Het
Trp53bp1 A C 2: 121,204,497 V103G probably benign Het
Trpv4 A G 5: 114,636,457 S189P probably benign Het
Ttll5 T G 12: 85,879,359 probably benign Het
Usp8 A G 2: 126,742,223 T451A probably benign Het
Vac14 G A 8: 110,636,952 D340N probably benign Het
Vars C A 17: 34,998,066 A471S probably benign Het
Vars A T 17: 35,010,619 H404L probably damaging Het
Vmn2r70 T C 7: 85,566,044 N94S probably damaging Het
Vpreb2 T C 16: 17,980,767 L39P probably damaging Het
Vps13a A T 19: 16,640,810 L693* probably null Het
Wapl A G 14: 34,733,794 I176V probably benign Het
Wdr31 G T 4: 62,464,033 L4I possibly damaging Het
Other mutations in Lrrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Lrrd1 APN 5 3850573 missense possibly damaging 0.94
IGL00329:Lrrd1 APN 5 3850081 missense possibly damaging 0.94
IGL00674:Lrrd1 APN 5 3849773 missense possibly damaging 0.92
IGL00691:Lrrd1 APN 5 3863929 missense probably damaging 0.98
IGL00839:Lrrd1 APN 5 3850017 missense probably benign 0.00
IGL00911:Lrrd1 APN 5 3865689 missense probably benign 0.07
IGL01754:Lrrd1 APN 5 3851432 missense probably damaging 1.00
IGL01981:Lrrd1 APN 5 3851267 missense probably damaging 1.00
IGL02003:Lrrd1 APN 5 3849857 missense probably damaging 0.99
IGL02223:Lrrd1 APN 5 3850211 missense probably benign
IGL02477:Lrrd1 APN 5 3865770 missense probably benign
IGL02609:Lrrd1 APN 5 3858803 missense probably benign 0.26
IGL02833:Lrrd1 APN 5 3850709 missense probably damaging 0.98
IGL02886:Lrrd1 APN 5 3851534 missense probably benign 0.00
IGL02896:Lrrd1 APN 5 3851473 missense probably benign 0.08
R0138:Lrrd1 UTSW 5 3851345 missense probably benign 0.04
R0305:Lrrd1 UTSW 5 3865707 missense probably damaging 1.00
R0346:Lrrd1 UTSW 5 3850215 missense probably benign 0.03
R0455:Lrrd1 UTSW 5 3866425 missense probably benign 0.21
R1717:Lrrd1 UTSW 5 3850580 missense probably damaging 0.99
R1719:Lrrd1 UTSW 5 3850483 splice site probably null
R1836:Lrrd1 UTSW 5 3865709 missense probably benign 0.36
R1951:Lrrd1 UTSW 5 3851488 missense probably damaging 1.00
R2199:Lrrd1 UTSW 5 3866478 missense possibly damaging 0.86
R3751:Lrrd1 UTSW 5 3850282 missense probably benign 0.37
R3752:Lrrd1 UTSW 5 3850282 missense probably benign 0.37
R3837:Lrrd1 UTSW 5 3850204 missense possibly damaging 0.73
R3862:Lrrd1 UTSW 5 3851248 missense probably benign 0.00
R3863:Lrrd1 UTSW 5 3851248 missense probably benign 0.00
R3864:Lrrd1 UTSW 5 3851248 missense probably benign 0.00
R4816:Lrrd1 UTSW 5 3851126 nonsense probably null
R5225:Lrrd1 UTSW 5 3858735 missense probably benign 0.00
R5721:Lrrd1 UTSW 5 3850619 missense probably benign 0.13
R5791:Lrrd1 UTSW 5 3851254 missense probably benign 0.11
R6077:Lrrd1 UTSW 5 3850837 missense probably benign 0.01
R6229:Lrrd1 UTSW 5 3863887 missense probably damaging 1.00
R6330:Lrrd1 UTSW 5 3850629 missense probably damaging 1.00
R6588:Lrrd1 UTSW 5 3851386 missense probably benign 0.19
R6734:Lrrd1 UTSW 5 3850226 missense possibly damaging 0.95
R6932:Lrrd1 UTSW 5 3851395 missense probably benign 0.06
R7180:Lrrd1 UTSW 5 3851459 missense probably damaging 1.00
R7771:Lrrd1 UTSW 5 3866476 missense possibly damaging 0.84
Z1176:Lrrd1 UTSW 5 3850025 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGTGCCAGGCTCATGGTGAATG -3'
(R):5'- AACAGCCCAGAGGTCAGGTTTCAG -3'

Sequencing Primer
(F):5'- ATACACTGTCTTCAGCTAACTTCAG -3'
(R):5'- TCAGTTCTGTAAGTGCAAGGTAAG -3'
Posted On2013-05-09