Incidental Mutation 'R4355:Kcnmb4'
ID 327502
Institutional Source Beutler Lab
Gene Symbol Kcnmb4
Ensembl Gene ENSMUSG00000054934
Gene Name potassium large conductance calcium-activated channel, subfamily M, beta member 4
Synonyms 2900045G12Rik, Slowpoke beta 4
MMRRC Submission 041108-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4355 (G1)
Quality Score 184
Status Validated
Chromosome 10
Chromosomal Location 116417861-116473878 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 116473284 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 80 (S80P)
Ref Sequence ENSEMBL: ENSMUSP00000065384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068233]
AlphaFold Q9JIN6
Predicted Effect possibly damaging
Transcript: ENSMUST00000068233
AA Change: S80P

PolyPhen 2 Score 0.567 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000065384
Gene: ENSMUSG00000054934
AA Change: S80P

DomainStartEndE-ValueType
Pfam:CaKB 8 203 2.7e-78 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000080943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000087965
SMART Domains Protein: ENSMUSP00000085278
Gene: ENSMUSG00000054934

DomainStartEndE-ValueType
Pfam:CaKB 1 110 1.6e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164271
Meta Mutation Damage Score 0.1606 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit and the modulatory beta subunit. The protein encoded by this gene is an auxiliary beta subunit which slows activation kinetics, leads to steeper calcium sensitivity, and shifts the voltage range of current activation to more negative potentials than does the beta 1 subunit. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a T G 8: 43,570,185 Q89H probably benign Het
Adgrb1 T C 15: 74,543,662 F697S probably damaging Het
Adgrl2 A T 3: 148,839,152 V769E probably damaging Het
Aldh7a1 A T 18: 56,548,494 F173L probably null Het
Arntl A G 7: 113,303,406 I421V possibly damaging Het
Bcl3 G T 7: 19,811,580 C208* probably null Het
Casz1 T C 4: 148,952,335 S1685P unknown Het
Cep250 A G 2: 155,991,525 E1789G probably damaging Het
Cep76 A T 18: 67,626,640 D334E probably benign Het
Clca3b A T 3: 144,825,458 probably null Het
Col9a3 A G 2: 180,606,478 S208G probably benign Het
Ddx47 T C 6: 135,021,505 V388A probably benign Het
Dync1h1 C T 12: 110,632,899 A1896V possibly damaging Het
Eif2ak2 T A 17: 78,858,534 R411S probably benign Het
F7 A G 8: 13,034,774 T267A probably benign Het
Fras1 C A 5: 96,700,242 D1770E probably benign Het
G2e3 T A 12: 51,365,337 Y387N probably benign Het
Hspg2 C T 4: 137,529,418 L1491F probably damaging Het
Ighv3-4 T C 12: 114,253,640 I110M probably benign Het
Itgb5 T A 16: 33,844,997 C28S probably damaging Het
Kbtbd11 C A 8: 15,028,578 N392K probably damaging Het
Kif21a C T 15: 90,970,833 C721Y probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klrc3 T C 6: 129,639,162 M189V probably benign Het
Macf1 T A 4: 123,475,091 E394V possibly damaging Het
Mrgprb4 C T 7: 48,198,701 G160R possibly damaging Het
Myb A G 10: 21,152,617 S116P probably damaging Het
Nf2 G A 11: 4,780,613 Q513* probably null Het
Nmnat3 C T 9: 98,410,152 T150M possibly damaging Het
Olfr361 C A 2: 37,084,930 V273F probably benign Het
Olfr743 T C 14: 50,533,759 C116R possibly damaging Het
Patj T G 4: 98,650,454 C210W possibly damaging Het
Pde3b A G 7: 114,416,287 H246R probably benign Het
Pnp2 A G 14: 50,959,625 H56R probably benign Het
Prkg1 A G 19: 30,569,229 probably benign Het
Rhbdf1 C T 11: 32,216,236 S8N probably damaging Het
Rimbp3 A G 16: 17,209,692 K327E possibly damaging Het
Rnf219 A G 14: 104,479,257 V560A probably benign Het
Rsph6a T A 7: 19,067,078 probably null Het
Ryr2 T C 13: 11,649,812 N3535S probably benign Het
Ssfa2 A G 2: 79,641,998 N132S probably benign Het
Ston1 T G 17: 88,637,008 V614G probably damaging Het
Svep1 T A 4: 58,138,695 T466S possibly damaging Het
Tas2r109 A T 6: 132,980,181 I262N probably benign Het
Tmtc1 T C 6: 148,355,098 probably benign Het
Tshz2 G A 2: 169,884,938 E16K possibly damaging Het
Ufsp2 T A 8: 45,985,465 S193R possibly damaging Het
Ugt2b5 C A 5: 87,139,763 E182* probably null Het
Usp43 A G 11: 67,891,464 V376A probably benign Het
Utp15 A T 13: 98,259,247 F76I possibly damaging Het
Wdr62 A C 7: 30,242,248 L1141R probably damaging Het
Zfp418 T A 7: 7,172,162 M18K probably benign Het
Other mutations in Kcnmb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Kcnmb4 APN 10 116473346 missense probably benign 0.34
IGL02016:Kcnmb4 APN 10 116446462 splice site probably benign
R1499:Kcnmb4 UTSW 10 116473298 missense possibly damaging 0.52
R4361:Kcnmb4 UTSW 10 116473505 missense probably benign 0.13
R5058:Kcnmb4 UTSW 10 116463928 intron probably benign
R5074:Kcnmb4 UTSW 10 116473197 missense probably benign 0.00
R5463:Kcnmb4 UTSW 10 116473505 missense probably benign 0.13
R6562:Kcnmb4 UTSW 10 116473184 critical splice donor site probably null
R6883:Kcnmb4 UTSW 10 116473343 missense probably benign 0.00
R7103:Kcnmb4 UTSW 10 116473259 missense possibly damaging 0.94
R7486:Kcnmb4 UTSW 10 116418275 missense probably benign 0.13
R8284:Kcnmb4 UTSW 10 116418253 missense probably damaging 1.00
R8324:Kcnmb4 UTSW 10 116418314 missense probably damaging 1.00
R8377:Kcnmb4 UTSW 10 116446385 missense probably benign 0.35
R8856:Kcnmb4 UTSW 10 116446394 missense possibly damaging 0.60
R8955:Kcnmb4 UTSW 10 116473476 nonsense probably null
R8991:Kcnmb4 UTSW 10 116446333 missense probably benign 0.00
R9219:Kcnmb4 UTSW 10 116473467 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTCTTCCCCTGGGGTCTAAC -3'
(R):5'- CAGGGTGTCTTACGAGTACACG -3'

Sequencing Primer
(F):5'- TGGGGTCTAACCGGGAC -3'
(R):5'- CCGAAGACAAGAGCATCCGG -3'
Posted On 2015-07-07