Incidental Mutation 'R4355:Usp43'
ID 327505
Institutional Source Beutler Lab
Gene Symbol Usp43
Ensembl Gene ENSMUSG00000020905
Gene Name ubiquitin specific peptidase 43
Synonyms C630032K07Rik
MMRRC Submission 041108-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4355 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 67745349-67812979 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 67782290 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 376 (V376A)
Ref Sequence ENSEMBL: ENSMUSP00000104317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021288] [ENSMUST00000108677]
AlphaFold Q8BUM9
Predicted Effect probably benign
Transcript: ENSMUST00000021288
AA Change: V376A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000021288
Gene: ENSMUSG00000020905
AA Change: V376A

DomainStartEndE-ValueType
low complexity region 8 54 N/A INTRINSIC
low complexity region 59 87 N/A INTRINSIC
Pfam:UCH 100 707 2.8e-61 PFAM
Pfam:UCH_1 101 297 1.3e-6 PFAM
Pfam:UCH_1 503 689 5.2e-13 PFAM
low complexity region 717 731 N/A INTRINSIC
low complexity region 958 972 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108677
AA Change: V376A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000104317
Gene: ENSMUSG00000020905
AA Change: V376A

DomainStartEndE-ValueType
low complexity region 8 54 N/A INTRINSIC
low complexity region 59 87 N/A INTRINSIC
Pfam:UCH 100 702 3.5e-54 PFAM
Pfam:UCH_1 101 298 2.7e-7 PFAM
Pfam:UCH_1 503 684 1.2e-9 PFAM
low complexity region 712 726 N/A INTRINSIC
low complexity region 953 967 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a T G 8: 44,023,222 (GRCm39) Q89H probably benign Het
Adgrb1 T C 15: 74,415,511 (GRCm39) F697S probably damaging Het
Adgrl2 A T 3: 148,544,788 (GRCm39) V769E probably damaging Het
Aldh7a1 A T 18: 56,681,566 (GRCm39) F173L probably null Het
Bcl3 G T 7: 19,545,505 (GRCm39) C208* probably null Het
Bmal1 A G 7: 112,902,613 (GRCm39) I421V possibly damaging Het
Casz1 T C 4: 149,036,792 (GRCm39) S1685P unknown Het
Cep250 A G 2: 155,833,445 (GRCm39) E1789G probably damaging Het
Cep76 A T 18: 67,759,710 (GRCm39) D334E probably benign Het
Clca3b A T 3: 144,531,219 (GRCm39) probably null Het
Col9a3 A G 2: 180,248,271 (GRCm39) S208G probably benign Het
Ddx47 T C 6: 134,998,468 (GRCm39) V388A probably benign Het
Dync1h1 C T 12: 110,599,333 (GRCm39) A1896V possibly damaging Het
Eif2ak2 T A 17: 79,165,963 (GRCm39) R411S probably benign Het
F7 A G 8: 13,084,774 (GRCm39) T267A probably benign Het
Fras1 C A 5: 96,848,101 (GRCm39) D1770E probably benign Het
G2e3 T A 12: 51,412,120 (GRCm39) Y387N probably benign Het
Hspg2 C T 4: 137,256,729 (GRCm39) L1491F probably damaging Het
Ighv3-4 T C 12: 114,217,260 (GRCm39) I110M probably benign Het
Itgb5 T A 16: 33,665,367 (GRCm39) C28S probably damaging Het
Itprid2 A G 2: 79,472,342 (GRCm39) N132S probably benign Het
Kbtbd11 C A 8: 15,078,578 (GRCm39) N392K probably damaging Het
Kcnmb4 A G 10: 116,309,189 (GRCm39) S80P possibly damaging Het
Kif21a C T 15: 90,855,036 (GRCm39) C721Y probably benign Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Klrc3 T C 6: 129,616,125 (GRCm39) M189V probably benign Het
Macf1 T A 4: 123,368,884 (GRCm39) E394V possibly damaging Het
Mrgprb4 C T 7: 47,848,449 (GRCm39) G160R possibly damaging Het
Myb A G 10: 21,028,516 (GRCm39) S116P probably damaging Het
Nf2 G A 11: 4,730,613 (GRCm39) Q513* probably null Het
Nmnat3 C T 9: 98,292,205 (GRCm39) T150M possibly damaging Het
Obi1 A G 14: 104,716,693 (GRCm39) V560A probably benign Het
Or11g27 T C 14: 50,771,216 (GRCm39) C116R possibly damaging Het
Or12k8 C A 2: 36,974,942 (GRCm39) V273F probably benign Het
Patj T G 4: 98,538,691 (GRCm39) C210W possibly damaging Het
Pde3b A G 7: 114,015,522 (GRCm39) H246R probably benign Het
Pnp2 A G 14: 51,197,082 (GRCm39) H56R probably benign Het
Prkg1 A G 19: 30,546,629 (GRCm39) probably benign Het
Rhbdf1 C T 11: 32,166,236 (GRCm39) S8N probably damaging Het
Rimbp3 A G 16: 17,027,556 (GRCm39) K327E possibly damaging Het
Rsph6a T A 7: 18,801,003 (GRCm39) probably null Het
Ryr2 T C 13: 11,664,698 (GRCm39) N3535S probably benign Het
Ston1 T G 17: 88,944,436 (GRCm39) V614G probably damaging Het
Svep1 T A 4: 58,138,695 (GRCm39) T466S possibly damaging Het
Tas2r109 A T 6: 132,957,144 (GRCm39) I262N probably benign Het
Tmtc1 T C 6: 148,256,596 (GRCm39) probably benign Het
Tshz2 G A 2: 169,726,858 (GRCm39) E16K possibly damaging Het
Ufsp2 T A 8: 46,438,502 (GRCm39) S193R possibly damaging Het
Ugt2b5 C A 5: 87,287,622 (GRCm39) E182* probably null Het
Utp15 A T 13: 98,395,755 (GRCm39) F76I possibly damaging Het
Wdr62 A C 7: 29,941,673 (GRCm39) L1141R probably damaging Het
Zfp418 T A 7: 7,175,161 (GRCm39) M18K probably benign Het
Other mutations in Usp43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Usp43 APN 11 67,782,245 (GRCm39) missense probably benign 0.08
IGL01536:Usp43 APN 11 67,746,764 (GRCm39) missense probably benign 0.01
IGL01754:Usp43 APN 11 67,747,007 (GRCm39) missense probably benign 0.06
IGL02057:Usp43 APN 11 67,747,113 (GRCm39) missense probably benign 0.02
IGL02638:Usp43 APN 11 67,746,581 (GRCm39) missense probably benign 0.06
IGL03105:Usp43 APN 11 67,770,802 (GRCm39) missense possibly damaging 0.82
IGL03155:Usp43 APN 11 67,767,315 (GRCm39) missense probably damaging 1.00
IGL03380:Usp43 APN 11 67,766,142 (GRCm39) missense possibly damaging 0.67
R0207:Usp43 UTSW 11 67,767,325 (GRCm39) missense probably damaging 1.00
R0308:Usp43 UTSW 11 67,770,966 (GRCm39) missense probably damaging 1.00
R0350:Usp43 UTSW 11 67,767,324 (GRCm39) missense probably damaging 1.00
R0479:Usp43 UTSW 11 67,788,100 (GRCm39) missense possibly damaging 0.96
R1451:Usp43 UTSW 11 67,747,007 (GRCm39) missense probably benign 0.01
R1686:Usp43 UTSW 11 67,778,593 (GRCm39) missense probably damaging 0.99
R1750:Usp43 UTSW 11 67,770,779 (GRCm39) missense probably damaging 1.00
R1956:Usp43 UTSW 11 67,795,159 (GRCm39) missense probably damaging 1.00
R2107:Usp43 UTSW 11 67,746,566 (GRCm39) frame shift probably null
R2108:Usp43 UTSW 11 67,746,566 (GRCm39) frame shift probably null
R2112:Usp43 UTSW 11 67,812,536 (GRCm39) missense probably damaging 1.00
R2162:Usp43 UTSW 11 67,770,795 (GRCm39) missense probably damaging 1.00
R2336:Usp43 UTSW 11 67,782,258 (GRCm39) nonsense probably null
R4031:Usp43 UTSW 11 67,804,659 (GRCm39) missense probably damaging 1.00
R4410:Usp43 UTSW 11 67,746,716 (GRCm39) missense probably benign 0.00
R4479:Usp43 UTSW 11 67,747,233 (GRCm39) missense possibly damaging 0.96
R4569:Usp43 UTSW 11 67,789,788 (GRCm39) missense probably damaging 1.00
R4569:Usp43 UTSW 11 67,766,178 (GRCm39) nonsense probably null
R4737:Usp43 UTSW 11 67,746,331 (GRCm39) missense probably damaging 1.00
R5395:Usp43 UTSW 11 67,788,184 (GRCm39) critical splice acceptor site probably null
R5466:Usp43 UTSW 11 67,804,709 (GRCm39) missense probably damaging 0.99
R5686:Usp43 UTSW 11 67,812,742 (GRCm39) unclassified probably benign
R6106:Usp43 UTSW 11 67,770,733 (GRCm39) missense probably benign 0.00
R7205:Usp43 UTSW 11 67,774,110 (GRCm39) missense probably null 1.00
R7360:Usp43 UTSW 11 67,767,155 (GRCm39) splice site probably null
R7426:Usp43 UTSW 11 67,783,842 (GRCm39) missense possibly damaging 0.60
R7755:Usp43 UTSW 11 67,782,294 (GRCm39) missense possibly damaging 0.94
R7937:Usp43 UTSW 11 67,746,615 (GRCm39) missense probably damaging 0.96
R8054:Usp43 UTSW 11 67,782,284 (GRCm39) missense probably damaging 0.96
R8410:Usp43 UTSW 11 67,747,146 (GRCm39) missense probably damaging 1.00
R8792:Usp43 UTSW 11 67,767,244 (GRCm39) nonsense probably null
R8865:Usp43 UTSW 11 67,789,788 (GRCm39) missense probably damaging 1.00
R8879:Usp43 UTSW 11 67,789,707 (GRCm39) splice site probably benign
R8906:Usp43 UTSW 11 67,782,307 (GRCm39) missense possibly damaging 0.51
R9287:Usp43 UTSW 11 67,770,922 (GRCm39) missense probably damaging 0.98
R9303:Usp43 UTSW 11 67,767,345 (GRCm39) missense probably damaging 1.00
R9305:Usp43 UTSW 11 67,767,345 (GRCm39) missense probably damaging 1.00
Z1088:Usp43 UTSW 11 67,746,866 (GRCm39) missense probably benign 0.39
Z1176:Usp43 UTSW 11 67,812,667 (GRCm39) missense unknown
Z1177:Usp43 UTSW 11 67,812,858 (GRCm39) missense unknown
Z1177:Usp43 UTSW 11 67,746,634 (GRCm39) missense possibly damaging 0.56
Z1186:Usp43 UTSW 11 67,747,332 (GRCm39) missense probably benign 0.41
Z1186:Usp43 UTSW 11 67,746,545 (GRCm39) small insertion probably benign
Z1187:Usp43 UTSW 11 67,747,332 (GRCm39) missense probably benign 0.41
Z1187:Usp43 UTSW 11 67,746,545 (GRCm39) small insertion probably benign
Z1188:Usp43 UTSW 11 67,747,332 (GRCm39) missense probably benign 0.41
Z1188:Usp43 UTSW 11 67,746,545 (GRCm39) small insertion probably benign
Z1189:Usp43 UTSW 11 67,747,332 (GRCm39) missense probably benign 0.41
Z1189:Usp43 UTSW 11 67,746,545 (GRCm39) small insertion probably benign
Z1190:Usp43 UTSW 11 67,747,332 (GRCm39) missense probably benign 0.41
Z1190:Usp43 UTSW 11 67,746,549 (GRCm39) small insertion probably benign
Z1190:Usp43 UTSW 11 67,746,545 (GRCm39) small insertion probably benign
Z1191:Usp43 UTSW 11 67,747,332 (GRCm39) missense probably benign 0.41
Z1191:Usp43 UTSW 11 67,746,545 (GRCm39) small insertion probably benign
Z1192:Usp43 UTSW 11 67,747,332 (GRCm39) missense probably benign 0.41
Z1192:Usp43 UTSW 11 67,746,545 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TGGCAAGCACAGGTCTACAAATC -3'
(R):5'- GCAGGTTATTTCAGGTTGCC -3'

Sequencing Primer
(F):5'- GGTCTACAAATCCCACTTACCACATG -3'
(R):5'- CAGGCCCATCTTTTAAAATTATTGGC -3'
Posted On 2015-07-07