Incidental Mutation 'R4355:Olfr743'
ID 327513
Institutional Source Beutler Lab
Gene Symbol Olfr743
Ensembl Gene ENSMUSG00000094285
Gene Name olfactory receptor 743
Synonyms Olfr264, GA_x6K02T2PMLR-6243196-6244132, MOR106-8P, GA_x6K02T2N6FY-3870-3385, GA_x6K02T2N6FY-2320-2039, MOR106-14, Olfr265, Olfr743-ps1
MMRRC Submission 041108-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock # R4355 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 50521839-50534955 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 50533759 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 116 (C116R)
Ref Sequence ENSEMBL: ENSMUSP00000150946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071294] [ENSMUST00000215793]
AlphaFold L7N1Y2
Predicted Effect possibly damaging
Transcript: ENSMUST00000071294
AA Change: C116R

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000071263
Gene: ENSMUSG00000094285
AA Change: C116R

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 1.6e-56 PFAM
Pfam:7tm_1 45 294 1e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215793
AA Change: C116R

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.5333 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a T G 8: 43,570,185 Q89H probably benign Het
Adgrb1 T C 15: 74,543,662 F697S probably damaging Het
Adgrl2 A T 3: 148,839,152 V769E probably damaging Het
Aldh7a1 A T 18: 56,548,494 F173L probably null Het
Arntl A G 7: 113,303,406 I421V possibly damaging Het
Bcl3 G T 7: 19,811,580 C208* probably null Het
Casz1 T C 4: 148,952,335 S1685P unknown Het
Cep250 A G 2: 155,991,525 E1789G probably damaging Het
Cep76 A T 18: 67,626,640 D334E probably benign Het
Clca3b A T 3: 144,825,458 probably null Het
Col9a3 A G 2: 180,606,478 S208G probably benign Het
Ddx47 T C 6: 135,021,505 V388A probably benign Het
Dync1h1 C T 12: 110,632,899 A1896V possibly damaging Het
Eif2ak2 T A 17: 78,858,534 R411S probably benign Het
F7 A G 8: 13,034,774 T267A probably benign Het
Fras1 C A 5: 96,700,242 D1770E probably benign Het
G2e3 T A 12: 51,365,337 Y387N probably benign Het
Hspg2 C T 4: 137,529,418 L1491F probably damaging Het
Ighv3-4 T C 12: 114,253,640 I110M probably benign Het
Itgb5 T A 16: 33,844,997 C28S probably damaging Het
Kbtbd11 C A 8: 15,028,578 N392K probably damaging Het
Kcnmb4 A G 10: 116,473,284 S80P possibly damaging Het
Kif21a C T 15: 90,970,833 C721Y probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klrc3 T C 6: 129,639,162 M189V probably benign Het
Macf1 T A 4: 123,475,091 E394V possibly damaging Het
Mrgprb4 C T 7: 48,198,701 G160R possibly damaging Het
Myb A G 10: 21,152,617 S116P probably damaging Het
Nf2 G A 11: 4,780,613 Q513* probably null Het
Nmnat3 C T 9: 98,410,152 T150M possibly damaging Het
Olfr361 C A 2: 37,084,930 V273F probably benign Het
Patj T G 4: 98,650,454 C210W possibly damaging Het
Pde3b A G 7: 114,416,287 H246R probably benign Het
Pnp2 A G 14: 50,959,625 H56R probably benign Het
Prkg1 A G 19: 30,569,229 probably benign Het
Rhbdf1 C T 11: 32,216,236 S8N probably damaging Het
Rimbp3 A G 16: 17,209,692 K327E possibly damaging Het
Rnf219 A G 14: 104,479,257 V560A probably benign Het
Rsph6a T A 7: 19,067,078 probably null Het
Ryr2 T C 13: 11,649,812 N3535S probably benign Het
Ssfa2 A G 2: 79,641,998 N132S probably benign Het
Ston1 T G 17: 88,637,008 V614G probably damaging Het
Svep1 T A 4: 58,138,695 T466S possibly damaging Het
Tas2r109 A T 6: 132,980,181 I262N probably benign Het
Tmtc1 T C 6: 148,355,098 probably benign Het
Tshz2 G A 2: 169,884,938 E16K possibly damaging Het
Ufsp2 T A 8: 45,985,465 S193R possibly damaging Het
Ugt2b5 C A 5: 87,139,763 E182* probably null Het
Usp43 A G 11: 67,891,464 V376A probably benign Het
Utp15 A T 13: 98,259,247 F76I possibly damaging Het
Wdr62 A C 7: 30,242,248 L1141R probably damaging Het
Zfp418 T A 7: 7,172,162 M18K probably benign Het
Other mutations in Olfr743
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Olfr743 APN 14 50533949 missense probably damaging 1.00
IGL01551:Olfr743 APN 14 50534161 missense probably benign
IGL02024:Olfr743 APN 14 50533850 missense probably benign 0.00
IGL02867:Olfr743 APN 14 50533513 missense probably benign
IGL02889:Olfr743 APN 14 50533513 missense probably benign
IGL03195:Olfr743 APN 14 50533420 missense probably benign
IGL03296:Olfr743 APN 14 50533945 missense possibly damaging 0.90
R0049:Olfr743 UTSW 14 50533694 missense probably damaging 1.00
R0049:Olfr743 UTSW 14 50533694 missense probably damaging 1.00
R0102:Olfr743 UTSW 14 50533631 missense probably damaging 1.00
R0556:Olfr743 UTSW 14 50533924 missense probably benign 0.01
R0626:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R0661:Olfr743 UTSW 14 50534095 missense probably benign
R0759:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R0761:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R0894:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1109:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1110:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1312:Olfr743 UTSW 14 50534195 missense probably benign
R1446:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1470:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1470:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1502:Olfr743 UTSW 14 50533777 missense possibly damaging 0.47
R1518:Olfr743 UTSW 14 50534165 missense probably damaging 1.00
R1529:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1624:Olfr743 UTSW 14 50533643 missense probably damaging 1.00
R1646:Olfr743 UTSW 14 50533583 missense probably benign 0.01
R1687:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1795:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R2011:Olfr743 UTSW 14 50533684 missense probably damaging 1.00
R2120:Olfr743 UTSW 14 50533946 missense probably damaging 1.00
R2697:Olfr743 UTSW 14 50533781 missense probably damaging 1.00
R2857:Olfr743 UTSW 14 50533440 missense probably benign 0.19
R2858:Olfr743 UTSW 14 50533440 missense probably benign 0.19
R3906:Olfr743 UTSW 14 50533754 missense probably benign 0.03
R4327:Olfr743 UTSW 14 50533514 missense probably benign 0.05
R4663:Olfr743 UTSW 14 50533604 missense probably damaging 1.00
R5214:Olfr743 UTSW 14 50534347 makesense probably null
R5964:Olfr743 UTSW 14 50534198 missense probably damaging 0.99
R6148:Olfr743 UTSW 14 50534321 missense probably benign 0.00
R6167:Olfr743 UTSW 14 50534155 missense probably damaging 1.00
R6301:Olfr743 UTSW 14 50534254 missense probably benign 0.02
R6616:Olfr743 UTSW 14 50533907 missense probably benign 0.43
R6910:Olfr743 UTSW 14 50533873 missense probably benign 0.31
R7076:Olfr743 UTSW 14 50533821 nonsense probably null
R7483:Olfr743 UTSW 14 50534015 missense probably benign 0.06
R7574:Olfr743 UTSW 14 50534313 missense probably benign 0.01
R7731:Olfr743 UTSW 14 50533684 missense probably damaging 0.99
R8691:Olfr743 UTSW 14 50533453 missense probably benign 0.01
R9072:Olfr743 UTSW 14 50533754 missense probably benign 0.03
R9073:Olfr743 UTSW 14 50533754 missense probably benign 0.03
R9321:Olfr743 UTSW 14 50534014 missense probably benign 0.01
R9478:Olfr743 UTSW 14 50533594 missense probably benign 0.01
R9557:Olfr743 UTSW 14 50534095 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGATCAGAGACTCCACACC -3'
(R):5'- CAAAAGAGGACCTGGGTCACAC -3'

Sequencing Primer
(F):5'- ACACCCCCATGTACCTCCTG -3'
(R):5'- GTGGTCTATAATTCTGGACCCACAG -3'
Posted On 2015-07-07