Incidental Mutation 'R4355:Kif21a'
ID 327518
Institutional Source Beutler Lab
Gene Symbol Kif21a
Ensembl Gene ENSMUSG00000022629
Gene Name kinesin family member 21A
Synonyms N-5 kinesin
MMRRC Submission 041108-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4355 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 90817479-90934151 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 90855036 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 721 (C721Y)
Ref Sequence ENSEMBL: ENSMUSP00000085985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067205] [ENSMUST00000088614] [ENSMUST00000100304] [ENSMUST00000109287] [ENSMUST00000109288] [ENSMUST00000229801]
AlphaFold Q9QXL2
Predicted Effect probably benign
Transcript: ENSMUST00000067205
AA Change: C708Y

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000066911
Gene: ENSMUSG00000022629
AA Change: C708Y

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 9e-9 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
low complexity region 589 628 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
coiled coil region 924 1008 N/A INTRINSIC
coiled coil region 1043 1066 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1251 1271 N/A INTRINSIC
WD40 1290 1327 1.21e-7 SMART
WD40 1330 1368 7.28e-2 SMART
WD40 1394 1432 3.33e-1 SMART
WD40 1435 1477 7e-4 SMART
WD40 1485 1523 2.4e-1 SMART
WD40 1527 1566 1.48e-2 SMART
WD40 1569 1606 2.07e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088614
AA Change: C721Y

PolyPhen 2 Score 0.169 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000085985
Gene: ENSMUSG00000022629
AA Change: C721Y

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 1e-8 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 564 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
low complexity region 602 641 N/A INTRINSIC
low complexity region 713 726 N/A INTRINSIC
coiled coil region 937 1021 N/A INTRINSIC
coiled coil region 1056 1079 N/A INTRINSIC
low complexity region 1114 1125 N/A INTRINSIC
low complexity region 1271 1283 N/A INTRINSIC
low complexity region 1300 1316 N/A INTRINSIC
WD40 1334 1371 1.21e-7 SMART
WD40 1374 1412 7.28e-2 SMART
WD40 1438 1476 3.33e-1 SMART
WD40 1479 1521 7e-4 SMART
WD40 1529 1567 2.4e-1 SMART
WD40 1571 1610 1.48e-2 SMART
WD40 1613 1650 2.07e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100304
AA Change: C721Y

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097877
Gene: ENSMUSG00000022629
AA Change: C721Y

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 1e-8 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 564 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
low complexity region 602 641 N/A INTRINSIC
low complexity region 713 726 N/A INTRINSIC
coiled coil region 937 1021 N/A INTRINSIC
coiled coil region 1056 1079 N/A INTRINSIC
low complexity region 1271 1283 N/A INTRINSIC
low complexity region 1300 1316 N/A INTRINSIC
WD40 1334 1371 1.21e-7 SMART
WD40 1374 1412 7.28e-2 SMART
WD40 1438 1476 3.33e-1 SMART
WD40 1479 1521 7e-4 SMART
WD40 1529 1567 2.4e-1 SMART
WD40 1571 1610 1.48e-2 SMART
WD40 1613 1650 2.07e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109287
AA Change: C708Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104910
Gene: ENSMUSG00000022629
AA Change: C708Y

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 9e-9 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
low complexity region 589 628 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
coiled coil region 924 1008 N/A INTRINSIC
coiled coil region 1043 1066 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
WD40 1229 1266 1.21e-7 SMART
WD40 1269 1307 7.28e-2 SMART
WD40 1333 1371 3.33e-1 SMART
WD40 1374 1416 7e-4 SMART
WD40 1424 1462 2.4e-1 SMART
WD40 1466 1505 1.48e-2 SMART
WD40 1508 1545 2.07e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109288
AA Change: C708Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104911
Gene: ENSMUSG00000022629
AA Change: C708Y

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 9e-9 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
low complexity region 589 628 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
coiled coil region 924 1008 N/A INTRINSIC
coiled coil region 1043 1066 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
WD40 1235 1272 1.21e-7 SMART
WD40 1275 1313 7.28e-2 SMART
WD40 1339 1377 3.33e-1 SMART
WD40 1380 1422 7e-4 SMART
WD40 1430 1468 2.4e-1 SMART
WD40 1472 1511 1.48e-2 SMART
WD40 1514 1551 2.07e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229801
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the KIF4 subfamily of kinesin-like motor proteins. The encoded protein is characterized by an N-terminal motor domain a coiled-coil stalk domain and a C-terminal WD-40 repeat domain. This protein may be involved in microtubule dependent transport. Mutations in this gene are the cause of congenital fibrosis of extraocular muscles-1. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a T G 8: 44,023,222 (GRCm39) Q89H probably benign Het
Adgrb1 T C 15: 74,415,511 (GRCm39) F697S probably damaging Het
Adgrl2 A T 3: 148,544,788 (GRCm39) V769E probably damaging Het
Aldh7a1 A T 18: 56,681,566 (GRCm39) F173L probably null Het
Bcl3 G T 7: 19,545,505 (GRCm39) C208* probably null Het
Bmal1 A G 7: 112,902,613 (GRCm39) I421V possibly damaging Het
Casz1 T C 4: 149,036,792 (GRCm39) S1685P unknown Het
Cep250 A G 2: 155,833,445 (GRCm39) E1789G probably damaging Het
Cep76 A T 18: 67,759,710 (GRCm39) D334E probably benign Het
Clca3b A T 3: 144,531,219 (GRCm39) probably null Het
Col9a3 A G 2: 180,248,271 (GRCm39) S208G probably benign Het
Ddx47 T C 6: 134,998,468 (GRCm39) V388A probably benign Het
Dync1h1 C T 12: 110,599,333 (GRCm39) A1896V possibly damaging Het
Eif2ak2 T A 17: 79,165,963 (GRCm39) R411S probably benign Het
F7 A G 8: 13,084,774 (GRCm39) T267A probably benign Het
Fras1 C A 5: 96,848,101 (GRCm39) D1770E probably benign Het
G2e3 T A 12: 51,412,120 (GRCm39) Y387N probably benign Het
Hspg2 C T 4: 137,256,729 (GRCm39) L1491F probably damaging Het
Ighv3-4 T C 12: 114,217,260 (GRCm39) I110M probably benign Het
Itgb5 T A 16: 33,665,367 (GRCm39) C28S probably damaging Het
Itprid2 A G 2: 79,472,342 (GRCm39) N132S probably benign Het
Kbtbd11 C A 8: 15,078,578 (GRCm39) N392K probably damaging Het
Kcnmb4 A G 10: 116,309,189 (GRCm39) S80P possibly damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Klrc3 T C 6: 129,616,125 (GRCm39) M189V probably benign Het
Macf1 T A 4: 123,368,884 (GRCm39) E394V possibly damaging Het
Mrgprb4 C T 7: 47,848,449 (GRCm39) G160R possibly damaging Het
Myb A G 10: 21,028,516 (GRCm39) S116P probably damaging Het
Nf2 G A 11: 4,730,613 (GRCm39) Q513* probably null Het
Nmnat3 C T 9: 98,292,205 (GRCm39) T150M possibly damaging Het
Obi1 A G 14: 104,716,693 (GRCm39) V560A probably benign Het
Or11g27 T C 14: 50,771,216 (GRCm39) C116R possibly damaging Het
Or12k8 C A 2: 36,974,942 (GRCm39) V273F probably benign Het
Patj T G 4: 98,538,691 (GRCm39) C210W possibly damaging Het
Pde3b A G 7: 114,015,522 (GRCm39) H246R probably benign Het
Pnp2 A G 14: 51,197,082 (GRCm39) H56R probably benign Het
Prkg1 A G 19: 30,546,629 (GRCm39) probably benign Het
Rhbdf1 C T 11: 32,166,236 (GRCm39) S8N probably damaging Het
Rimbp3 A G 16: 17,027,556 (GRCm39) K327E possibly damaging Het
Rsph6a T A 7: 18,801,003 (GRCm39) probably null Het
Ryr2 T C 13: 11,664,698 (GRCm39) N3535S probably benign Het
Ston1 T G 17: 88,944,436 (GRCm39) V614G probably damaging Het
Svep1 T A 4: 58,138,695 (GRCm39) T466S possibly damaging Het
Tas2r109 A T 6: 132,957,144 (GRCm39) I262N probably benign Het
Tmtc1 T C 6: 148,256,596 (GRCm39) probably benign Het
Tshz2 G A 2: 169,726,858 (GRCm39) E16K possibly damaging Het
Ufsp2 T A 8: 46,438,502 (GRCm39) S193R possibly damaging Het
Ugt2b5 C A 5: 87,287,622 (GRCm39) E182* probably null Het
Usp43 A G 11: 67,782,290 (GRCm39) V376A probably benign Het
Utp15 A T 13: 98,395,755 (GRCm39) F76I possibly damaging Het
Wdr62 A C 7: 29,941,673 (GRCm39) L1141R probably damaging Het
Zfp418 T A 7: 7,175,161 (GRCm39) M18K probably benign Het
Other mutations in Kif21a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Kif21a APN 15 90,821,504 (GRCm39) missense probably damaging 1.00
IGL01476:Kif21a APN 15 90,828,067 (GRCm39) missense possibly damaging 0.66
IGL01617:Kif21a APN 15 90,879,840 (GRCm39) splice site probably benign
IGL01736:Kif21a APN 15 90,843,948 (GRCm39) missense possibly damaging 0.59
IGL01923:Kif21a APN 15 90,840,633 (GRCm39) missense probably damaging 0.96
IGL01985:Kif21a APN 15 90,875,970 (GRCm39) missense probably damaging 1.00
IGL02304:Kif21a APN 15 90,849,738 (GRCm39) missense probably damaging 1.00
IGL02589:Kif21a APN 15 90,869,489 (GRCm39) missense probably damaging 1.00
IGL03115:Kif21a APN 15 90,869,598 (GRCm39) missense probably damaging 0.99
IGL03211:Kif21a APN 15 90,882,166 (GRCm39) missense possibly damaging 0.73
IGL03372:Kif21a APN 15 90,840,579 (GRCm39) missense probably benign 0.38
reflex UTSW 15 90,852,561 (GRCm39) missense probably null 1.00
R0052:Kif21a UTSW 15 90,855,060 (GRCm39) missense probably damaging 0.98
R0052:Kif21a UTSW 15 90,855,060 (GRCm39) missense probably damaging 0.98
R0304:Kif21a UTSW 15 90,860,724 (GRCm39) splice site probably null
R0378:Kif21a UTSW 15 90,853,977 (GRCm39) splice site probably null
R0420:Kif21a UTSW 15 90,852,257 (GRCm39) unclassified probably benign
R0536:Kif21a UTSW 15 90,843,886 (GRCm39) splice site probably benign
R0826:Kif21a UTSW 15 90,881,744 (GRCm39) critical splice donor site probably null
R0971:Kif21a UTSW 15 90,824,784 (GRCm39) missense possibly damaging 0.46
R1052:Kif21a UTSW 15 90,819,853 (GRCm39) missense probably benign 0.17
R1168:Kif21a UTSW 15 90,877,956 (GRCm39) missense probably damaging 1.00
R1324:Kif21a UTSW 15 90,832,525 (GRCm39) critical splice donor site probably null
R1471:Kif21a UTSW 15 90,840,622 (GRCm39) missense probably benign 0.04
R1625:Kif21a UTSW 15 90,826,378 (GRCm39) missense probably damaging 1.00
R1636:Kif21a UTSW 15 90,869,008 (GRCm39) splice site probably benign
R1647:Kif21a UTSW 15 90,878,570 (GRCm39) missense probably damaging 1.00
R1648:Kif21a UTSW 15 90,878,570 (GRCm39) missense probably damaging 1.00
R1699:Kif21a UTSW 15 90,843,946 (GRCm39) missense probably damaging 0.99
R1703:Kif21a UTSW 15 90,833,250 (GRCm39) splice site probably null
R1795:Kif21a UTSW 15 90,856,930 (GRCm39) splice site probably null
R1812:Kif21a UTSW 15 90,855,969 (GRCm39) missense possibly damaging 0.63
R1959:Kif21a UTSW 15 90,855,051 (GRCm39) missense probably damaging 0.99
R1960:Kif21a UTSW 15 90,855,051 (GRCm39) missense probably damaging 0.99
R1961:Kif21a UTSW 15 90,855,051 (GRCm39) missense probably damaging 0.99
R1996:Kif21a UTSW 15 90,878,574 (GRCm39) nonsense probably null
R2230:Kif21a UTSW 15 90,869,565 (GRCm39) nonsense probably null
R2231:Kif21a UTSW 15 90,869,565 (GRCm39) nonsense probably null
R2232:Kif21a UTSW 15 90,869,565 (GRCm39) nonsense probably null
R2424:Kif21a UTSW 15 90,855,399 (GRCm39) missense probably damaging 1.00
R2429:Kif21a UTSW 15 90,882,208 (GRCm39) missense probably damaging 1.00
R2513:Kif21a UTSW 15 90,878,594 (GRCm39) missense possibly damaging 0.96
R2846:Kif21a UTSW 15 90,818,667 (GRCm39) missense probably benign
R3027:Kif21a UTSW 15 90,856,845 (GRCm39) missense probably damaging 0.99
R3624:Kif21a UTSW 15 90,849,798 (GRCm39) missense probably damaging 0.99
R3820:Kif21a UTSW 15 90,852,277 (GRCm39) missense probably benign 0.17
R3923:Kif21a UTSW 15 90,821,497 (GRCm39) missense possibly damaging 0.46
R3962:Kif21a UTSW 15 90,869,612 (GRCm39) missense probably damaging 1.00
R4516:Kif21a UTSW 15 90,855,345 (GRCm39) missense probably benign 0.38
R4530:Kif21a UTSW 15 90,852,292 (GRCm39) splice site probably null
R4612:Kif21a UTSW 15 90,852,426 (GRCm39) splice site probably null
R4674:Kif21a UTSW 15 90,824,748 (GRCm39) missense possibly damaging 0.66
R4675:Kif21a UTSW 15 90,824,748 (GRCm39) missense possibly damaging 0.66
R4698:Kif21a UTSW 15 90,840,508 (GRCm39) missense possibly damaging 0.85
R4712:Kif21a UTSW 15 90,868,958 (GRCm39) missense probably damaging 1.00
R4955:Kif21a UTSW 15 90,821,393 (GRCm39) missense probably damaging 1.00
R4974:Kif21a UTSW 15 90,833,213 (GRCm39) missense probably benign 0.16
R5034:Kif21a UTSW 15 90,852,561 (GRCm39) missense probably null 1.00
R5165:Kif21a UTSW 15 90,840,579 (GRCm39) missense probably benign 0.38
R5464:Kif21a UTSW 15 90,878,058 (GRCm39) missense probably damaging 1.00
R5541:Kif21a UTSW 15 90,852,316 (GRCm39) missense probably damaging 0.99
R5757:Kif21a UTSW 15 90,835,548 (GRCm39) missense probably damaging 1.00
R5936:Kif21a UTSW 15 90,819,850 (GRCm39) missense possibly damaging 0.95
R5976:Kif21a UTSW 15 90,820,015 (GRCm39) missense probably damaging 1.00
R6074:Kif21a UTSW 15 90,865,095 (GRCm39) missense probably benign
R6638:Kif21a UTSW 15 90,850,610 (GRCm39) missense probably damaging 1.00
R6723:Kif21a UTSW 15 90,824,649 (GRCm39) missense probably damaging 0.97
R6785:Kif21a UTSW 15 90,819,933 (GRCm39) missense probably damaging 1.00
R6977:Kif21a UTSW 15 90,865,040 (GRCm39) missense probably damaging 1.00
R7058:Kif21a UTSW 15 90,833,106 (GRCm39) splice site probably null
R7147:Kif21a UTSW 15 90,865,086 (GRCm39) missense probably benign 0.13
R7290:Kif21a UTSW 15 90,851,432 (GRCm39) nonsense probably null
R7438:Kif21a UTSW 15 90,877,999 (GRCm39) missense probably benign 0.37
R7593:Kif21a UTSW 15 90,828,064 (GRCm39) missense probably benign 0.03
R7661:Kif21a UTSW 15 90,865,122 (GRCm39) missense possibly damaging 0.89
R7891:Kif21a UTSW 15 90,840,517 (GRCm39) missense probably damaging 1.00
R8137:Kif21a UTSW 15 90,852,645 (GRCm39) missense probably benign
R8182:Kif21a UTSW 15 90,819,964 (GRCm39) missense possibly damaging 0.77
R8303:Kif21a UTSW 15 90,855,399 (GRCm39) missense probably damaging 0.99
R8388:Kif21a UTSW 15 90,843,327 (GRCm39) missense possibly damaging 0.60
R8867:Kif21a UTSW 15 90,852,382 (GRCm39) missense probably damaging 0.96
R8921:Kif21a UTSW 15 90,855,930 (GRCm39) missense probably benign 0.04
R8984:Kif21a UTSW 15 90,840,559 (GRCm39) missense probably benign 0.00
R9024:Kif21a UTSW 15 90,821,399 (GRCm39) nonsense probably null
R9254:Kif21a UTSW 15 90,854,030 (GRCm39) missense probably damaging 0.99
R9366:Kif21a UTSW 15 90,843,951 (GRCm39) missense probably damaging 0.99
R9379:Kif21a UTSW 15 90,854,030 (GRCm39) missense probably damaging 0.99
R9393:Kif21a UTSW 15 90,853,981 (GRCm39) missense probably benign 0.00
R9518:Kif21a UTSW 15 90,840,676 (GRCm39) missense probably damaging 1.00
R9712:Kif21a UTSW 15 90,879,715 (GRCm39) missense probably benign 0.13
R9712:Kif21a UTSW 15 90,869,528 (GRCm39) missense probably damaging 0.98
R9721:Kif21a UTSW 15 90,855,330 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGAGTAGTCGAGGTACCTTGG -3'
(R):5'- AGTCTCCATCCTTACTCAGGGC -3'

Sequencing Primer
(F):5'- AGTCGAGGTACCTTGGTTTTC -3'
(R):5'- TGGAGCCCAAAACCTTAGTCATTAG -3'
Posted On 2015-07-07