Mutagenetix > Incidental Mutation

Incidental Mutation 'R4355:Rimbp3'

327519

Institutional Source

Beutler Lab

Gene Symbol

Rimbp3

Ensembl Gene

ENSMUSG00000071636

Gene Name

RIMS binding protein 3

Synonyms

RIM-BP3, LOC239731, LOC385766

MMRRC Submission

041108-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.236) question?

Stock #

R4355 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

17208603-17213982 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 17209692 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 327 (K327E)

Ref Sequence

ENSEMBL: ENSMUSP00000127909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169803]

AlphaFold

Q3V0F0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169803
AA Change: K327E

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000127909
Gene: ENSMUSG00000071636
AA Change: K327E

Domain	Start	End	E-Value	Type
coiled coil region	25	56	N/A	INTRINSIC
coiled coil region	84	145	N/A	INTRINSIC
low complexity region	308	324	N/A	INTRINSIC
coiled coil region	395	431	N/A	INTRINSIC
coiled coil region	547	610	N/A	INTRINSIC
low complexity region	688	701	N/A	INTRINSIC
low complexity region	769	780	N/A	INTRINSIC
SH3	825	888	7.58e-8	SMART
low complexity region	913	924	N/A	INTRINSIC
FN3	980	1052	2.21e-3	SMART
FN3	1073	1160	1.91e1	SMART
low complexity region	1236	1243	N/A	INTRINSIC
SH3	1423	1487	5.08e-2	SMART
SH3	1539	1602	5.97e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000179034

Meta Mutation Damage Score

0.0916

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

100% (57/57)

MGI Phenotype

PHENOTYPE: Male mice homozygous for a null mutation display infertility with impaired spermiogenesis and defects in sperm head and flagellum morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam26a	T	G	8: 43,570,185	Q89H	probably benign	Het
Adgrb1	T	C	15: 74,543,662	F697S	probably damaging	Het
Adgrl2	A	T	3: 148,839,152	V769E	probably damaging	Het
Aldh7a1	A	T	18: 56,548,494	F173L	probably null	Het
Arntl	A	G	7: 113,303,406	I421V	possibly damaging	Het
Bcl3	G	T	7: 19,811,580	C208*	probably null	Het
Casz1	T	C	4: 148,952,335	S1685P	unknown	Het
Cep250	A	G	2: 155,991,525	E1789G	probably damaging	Het
Cep76	A	T	18: 67,626,640	D334E	probably benign	Het
Clca3b	A	T	3: 144,825,458		probably null	Het
Col9a3	A	G	2: 180,606,478	S208G	probably benign	Het
Ddx47	T	C	6: 135,021,505	V388A	probably benign	Het
Dync1h1	C	T	12: 110,632,899	A1896V	possibly damaging	Het
Eif2ak2	T	A	17: 78,858,534	R411S	probably benign	Het
F7	A	G	8: 13,034,774	T267A	probably benign	Het
Fras1	C	A	5: 96,700,242	D1770E	probably benign	Het
G2e3	T	A	12: 51,365,337	Y387N	probably benign	Het
Hspg2	C	T	4: 137,529,418	L1491F	probably damaging	Het
Ighv3-4	T	C	12: 114,253,640	I110M	probably benign	Het
Itgb5	T	A	16: 33,844,997	C28S	probably damaging	Het
Kbtbd11	C	A	8: 15,028,578	N392K	probably damaging	Het
Kcnmb4	A	G	10: 116,473,284	S80P	possibly damaging	Het
Kif21a	C	T	15: 90,970,833	C721Y	probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Klrc3	T	C	6: 129,639,162	M189V	probably benign	Het
Macf1	T	A	4: 123,475,091	E394V	possibly damaging	Het
Mrgprb4	C	T	7: 48,198,701	G160R	possibly damaging	Het
Myb	A	G	10: 21,152,617	S116P	probably damaging	Het
Nf2	G	A	11: 4,780,613	Q513*	probably null	Het
Nmnat3	C	T	9: 98,410,152	T150M	possibly damaging	Het
Olfr361	C	A	2: 37,084,930	V273F	probably benign	Het
Olfr743	T	C	14: 50,533,759	C116R	possibly damaging	Het
Patj	T	G	4: 98,650,454	C210W	possibly damaging	Het
Pde3b	A	G	7: 114,416,287	H246R	probably benign	Het
Pnp2	A	G	14: 50,959,625	H56R	probably benign	Het
Prkg1	A	G	19: 30,569,229		probably benign	Het
Rhbdf1	C	T	11: 32,216,236	S8N	probably damaging	Het
Rnf219	A	G	14: 104,479,257	V560A	probably benign	Het
Rsph6a	T	A	7: 19,067,078		probably null	Het
Ryr2	T	C	13: 11,649,812	N3535S	probably benign	Het
Ssfa2	A	G	2: 79,641,998	N132S	probably benign	Het
Ston1	T	G	17: 88,637,008	V614G	probably damaging	Het
Svep1	T	A	4: 58,138,695	T466S	possibly damaging	Het
Tas2r109	A	T	6: 132,980,181	I262N	probably benign	Het
Tmtc1	T	C	6: 148,355,098		probably benign	Het
Tshz2	G	A	2: 169,884,938	E16K	possibly damaging	Het
Ufsp2	T	A	8: 45,985,465	S193R	possibly damaging	Het
Ugt2b5	C	A	5: 87,139,763	E182*	probably null	Het
Usp43	A	G	11: 67,891,464	V376A	probably benign	Het
Utp15	A	T	13: 98,259,247	F76I	possibly damaging	Het
Wdr62	A	C	7: 30,242,248	L1141R	probably damaging	Het
Zfp418	T	A	7: 7,172,162	M18K	probably benign	Het

Other mutations in Rimbp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Rimbp3	APN	16	17209743	missense	probably benign	0.01
IGL00786:Rimbp3	APN	16	17211688	missense	probably damaging	0.99
IGL01411:Rimbp3	APN	16	17211094	missense	probably damaging	1.00
IGL01434:Rimbp3	APN	16	17211702	missense	probably benign	0.13
IGL01895:Rimbp3	APN	16	17211436	missense	probably damaging	0.99
IGL02322:Rimbp3	APN	16	17211615	missense	probably benign	0.00
IGL02649:Rimbp3	APN	16	17209608	nonsense	probably null
IGL03285:Rimbp3	APN	16	17213232	missense	probably benign	0.16
PIT4581001:Rimbp3	UTSW	16	17210716	missense	possibly damaging	0.76
R0279:Rimbp3	UTSW	16	17209453	missense	probably benign	0.00
R0465:Rimbp3	UTSW	16	17211780	missense	possibly damaging	0.86
R0605:Rimbp3	UTSW	16	17211699	missense	probably damaging	0.99
R0674:Rimbp3	UTSW	16	17212737	missense	probably benign	0.02
R1676:Rimbp3	UTSW	16	17211113	missense	probably benign	0.13
R1780:Rimbp3	UTSW	16	17212632	missense	probably benign
R1946:Rimbp3	UTSW	16	17210427	missense	probably benign	0.10
R2113:Rimbp3	UTSW	16	17209675	missense	probably benign	0.00
R3847:Rimbp3	UTSW	16	17210299	missense	probably benign	0.13
R3849:Rimbp3	UTSW	16	17210299	missense	probably benign	0.13
R3850:Rimbp3	UTSW	16	17210299	missense	probably benign	0.13
R4646:Rimbp3	UTSW	16	17213098	missense	probably damaging	0.99
R4669:Rimbp3	UTSW	16	17209189	missense	possibly damaging	0.88
R4732:Rimbp3	UTSW	16	17210601	missense	possibly damaging	0.94
R4733:Rimbp3	UTSW	16	17210601	missense	possibly damaging	0.94
R5025:Rimbp3	UTSW	16	17209807	missense	probably damaging	0.99
R5039:Rimbp3	UTSW	16	17213331	missense	probably damaging	0.99
R5177:Rimbp3	UTSW	16	17209917	missense	possibly damaging	0.85
R5311:Rimbp3	UTSW	16	17210844	missense	probably benign	0.00
R5942:Rimbp3	UTSW	16	17211888	missense	probably benign	0.00
R6063:Rimbp3	UTSW	16	17210917	missense	probably damaging	1.00
R6092:Rimbp3	UTSW	16	17212270	missense	probably damaging	1.00
R6126:Rimbp3	UTSW	16	17212276	missense	probably benign	0.25
R6288:Rimbp3	UTSW	16	17212908	missense	probably benign	0.22
R6446:Rimbp3	UTSW	16	17212929	missense	probably benign	0.00
R6773:Rimbp3	UTSW	16	17209015	missense	probably damaging	1.00
R7017:Rimbp3	UTSW	16	17209746	missense	probably benign	0.04
R7043:Rimbp3	UTSW	16	17211108	missense	probably damaging	1.00
R7048:Rimbp3	UTSW	16	17210326	missense	probably benign	0.20
R7378:Rimbp3	UTSW	16	17211204	missense	probably benign
R7440:Rimbp3	UTSW	16	17213201	missense	possibly damaging	0.78
R7788:Rimbp3	UTSW	16	17212704	missense	probably benign	0.00
R7879:Rimbp3	UTSW	16	17211046	missense	possibly damaging	0.71
R8071:Rimbp3	UTSW	16	17210863	missense	probably benign
R8272:Rimbp3	UTSW	16	17209105	missense	possibly damaging	0.85
R8419:Rimbp3	UTSW	16	17213022	missense	probably damaging	0.97
R8819:Rimbp3	UTSW	16	17210907	missense	probably benign	0.17
R8830:Rimbp3	UTSW	16	17209006	missense	probably damaging	0.98
R8936:Rimbp3	UTSW	16	17213020	missense	probably benign
R8982:Rimbp3	UTSW	16	17209647	missense	probably benign	0.11
R9365:Rimbp3	UTSW	16	17208756	missense	possibly damaging	0.93
R9799:Rimbp3	UTSW	16	17209777	missense	possibly damaging	0.88
Z1176:Rimbp3	UTSW	16	17209474	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TCGAAAGCCTGAACACTGGC -3'
(R):5'- CCGCAGATGCAAGTTTTCTTC -3'

Sequencing Primer
(F):5'- GGGTTCATTCTCCAAACGACCTG -3'
(R):5'- AGATGCAAGTTTTCTTCGCGCAG -3'

Posted On

2015-07-07