Mutagenetix > Incidental Mutation

Incidental Mutation 'R4355:Ston1'

327522

Institutional Source

Beutler Lab

Gene Symbol

Ston1

Ensembl Gene

ENSMUSG00000033855

Gene Name

stonin 1

Synonyms

MMRRC Submission

041108-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.214) question?

Stock #

R4355 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88597684-88662586 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 88637008 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 614 (V614G)

Ref Sequence

ENSEMBL: ENSMUSP00000131703 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064035] [ENSMUST00000137138] [ENSMUST00000150023] [ENSMUST00000163588]

AlphaFold

Q8CDJ8

Predicted Effect

probably damaging
Transcript: ENSMUST00000064035
AA Change: V614G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000067027
Gene: ENSMUSG00000033855
AA Change: V614G

Domain	Start	End	E-Value	Type
low complexity region	50	65	N/A	INTRINSIC
low complexity region	132	143	N/A	INTRINSIC
low complexity region	380	391	N/A	INTRINSIC
Pfam:Adap_comp_sub	396	707	5.5e-64	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000112216

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132384

Predicted Effect

probably benign
Transcript: ENSMUST00000137138

SMART Domains

Protein: ENSMUSP00000118522
Gene: ENSMUSG00000033855

Domain	Start	End	E-Value	Type
low complexity region	50	65	N/A	INTRINSIC
low complexity region	132	143	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000150023
AA Change: V614G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000122928
Gene: ENSMUSG00000033855
AA Change: V614G

Domain	Start	End	E-Value	Type
low complexity region	50	65	N/A	INTRINSIC
low complexity region	132	143	N/A	INTRINSIC
low complexity region	380	391	N/A	INTRINSIC
Pfam:Adap_comp_sub	396	707	5.5e-64	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153613

Predicted Effect

probably damaging
Transcript: ENSMUST00000163588
AA Change: V614G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131703
Gene: ENSMUSG00000033855
AA Change: V614G

Domain	Start	End	E-Value	Type
low complexity region	50	65	N/A	INTRINSIC
low complexity region	132	143	N/A	INTRINSIC
low complexity region	380	391	N/A	INTRINSIC
Pfam:Adap_comp_sub	396	711	2.1e-64	PFAM

Meta Mutation Damage Score

0.3241

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Endocytosis of cell surface proteins is mediated by a complex molecular machinery that assembles on the inner surface of the plasma membrane. This gene encodes one of two human homologs of the Drosophila melanogaster stoned B protein. This protein is related to components of the endocytic machinery and exhibits a modular structure consisting of an N-terminal proline-rich domain, a central region of homology specific to the human stoned B-like proteins, and a C-terminal region homologous to the mu subunits of adaptor protein (AP) complexes. Read-through transcription of this gene into the neighboring downstream gene, which encodes TFIIA-alpha/beta-like factor, generates a transcript (SALF), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are overtly normal. Mouse embryonic fibroblasts derived from homozygous null mice display alterations in focal adhesion dynamics and an increase in cellular signaling and directional cell migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam26a	T	G	8: 43,570,185	Q89H	probably benign	Het
Adgrb1	T	C	15: 74,543,662	F697S	probably damaging	Het
Adgrl2	A	T	3: 148,839,152	V769E	probably damaging	Het
Aldh7a1	A	T	18: 56,548,494	F173L	probably null	Het
Arntl	A	G	7: 113,303,406	I421V	possibly damaging	Het
Bcl3	G	T	7: 19,811,580	C208*	probably null	Het
Casz1	T	C	4: 148,952,335	S1685P	unknown	Het
Cep250	A	G	2: 155,991,525	E1789G	probably damaging	Het
Cep76	A	T	18: 67,626,640	D334E	probably benign	Het
Clca3b	A	T	3: 144,825,458		probably null	Het
Col9a3	A	G	2: 180,606,478	S208G	probably benign	Het
Ddx47	T	C	6: 135,021,505	V388A	probably benign	Het
Dync1h1	C	T	12: 110,632,899	A1896V	possibly damaging	Het
Eif2ak2	T	A	17: 78,858,534	R411S	probably benign	Het
F7	A	G	8: 13,034,774	T267A	probably benign	Het
Fras1	C	A	5: 96,700,242	D1770E	probably benign	Het
G2e3	T	A	12: 51,365,337	Y387N	probably benign	Het
Hspg2	C	T	4: 137,529,418	L1491F	probably damaging	Het
Ighv3-4	T	C	12: 114,253,640	I110M	probably benign	Het
Itgb5	T	A	16: 33,844,997	C28S	probably damaging	Het
Kbtbd11	C	A	8: 15,028,578	N392K	probably damaging	Het
Kcnmb4	A	G	10: 116,473,284	S80P	possibly damaging	Het
Kif21a	C	T	15: 90,970,833	C721Y	probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Klrc3	T	C	6: 129,639,162	M189V	probably benign	Het
Macf1	T	A	4: 123,475,091	E394V	possibly damaging	Het
Mrgprb4	C	T	7: 48,198,701	G160R	possibly damaging	Het
Myb	A	G	10: 21,152,617	S116P	probably damaging	Het
Nf2	G	A	11: 4,780,613	Q513*	probably null	Het
Nmnat3	C	T	9: 98,410,152	T150M	possibly damaging	Het
Olfr361	C	A	2: 37,084,930	V273F	probably benign	Het
Olfr743	T	C	14: 50,533,759	C116R	possibly damaging	Het
Patj	T	G	4: 98,650,454	C210W	possibly damaging	Het
Pde3b	A	G	7: 114,416,287	H246R	probably benign	Het
Pnp2	A	G	14: 50,959,625	H56R	probably benign	Het
Prkg1	A	G	19: 30,569,229		probably benign	Het
Rhbdf1	C	T	11: 32,216,236	S8N	probably damaging	Het
Rimbp3	A	G	16: 17,209,692	K327E	possibly damaging	Het
Rnf219	A	G	14: 104,479,257	V560A	probably benign	Het
Rsph6a	T	A	7: 19,067,078		probably null	Het
Ryr2	T	C	13: 11,649,812	N3535S	probably benign	Het
Ssfa2	A	G	2: 79,641,998	N132S	probably benign	Het
Svep1	T	A	4: 58,138,695	T466S	possibly damaging	Het
Tas2r109	A	T	6: 132,980,181	I262N	probably benign	Het
Tmtc1	T	C	6: 148,355,098		probably benign	Het
Tshz2	G	A	2: 169,884,938	E16K	possibly damaging	Het
Ufsp2	T	A	8: 45,985,465	S193R	possibly damaging	Het
Ugt2b5	C	A	5: 87,139,763	E182*	probably null	Het
Usp43	A	G	11: 67,891,464	V376A	probably benign	Het
Utp15	A	T	13: 98,259,247	F76I	possibly damaging	Het
Wdr62	A	C	7: 30,242,248	L1141R	probably damaging	Het
Zfp418	T	A	7: 7,172,162	M18K	probably benign	Het

Other mutations in Ston1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01092:Ston1	APN	17	88644443	missense	probably benign	0.00
IGL01593:Ston1	APN	17	88637010	missense	probably null	1.00
BB010:Ston1	UTSW	17	88636144	missense	probably benign	0.10
BB020:Ston1	UTSW	17	88636144	missense	probably benign	0.10
FR4449:Ston1	UTSW	17	88635525	missense	probably benign	0.38
R0610:Ston1	UTSW	17	88635281	missense	possibly damaging	0.49
R1421:Ston1	UTSW	17	88635793	missense	probably benign	0.02
R1620:Ston1	UTSW	17	88635816	missense	probably benign	0.01
R2002:Ston1	UTSW	17	88635529	missense	probably benign	0.01
R3108:Ston1	UTSW	17	88636155	nonsense	probably null
R3766:Ston1	UTSW	17	88635360	missense	probably damaging	1.00
R4222:Ston1	UTSW	17	88636771	missense	probably damaging	1.00
R4335:Ston1	UTSW	17	88635697	missense	probably damaging	1.00
R4867:Ston1	UTSW	17	88635694	missense	probably damaging	1.00
R4902:Ston1	UTSW	17	88645252	missense	probably damaging	0.99
R5084:Ston1	UTSW	17	88636574	missense	probably benign	0.00
R5434:Ston1	UTSW	17	88645311	utr 3 prime	probably benign
R5700:Ston1	UTSW	17	88644339	missense	probably damaging	1.00
R5858:Ston1	UTSW	17	88635631	missense	possibly damaging	0.93
R5863:Ston1	UTSW	17	88635945	missense	possibly damaging	0.64
R6458:Ston1	UTSW	17	88635303	missense	probably benign	0.14
R6459:Ston1	UTSW	17	88636468	missense	probably benign	0.16
R7012:Ston1	UTSW	17	88635985	missense	probably damaging	1.00
R7466:Ston1	UTSW	17	88635901	missense	probably benign	0.03
R7825:Ston1	UTSW	17	88636453	missense	possibly damaging	0.78
R7933:Ston1	UTSW	17	88636144	missense	probably benign	0.10
R8505:Ston1	UTSW	17	88635589	missense	probably benign	0.35
R8876:Ston1	UTSW	17	88635172	missense	probably benign
R9050:Ston1	UTSW	17	88636800	missense	probably benign	0.00
R9429:Ston1	UTSW	17	88635606	missense	probably benign
R9798:Ston1	UTSW	17	88637044	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGCTGCAGGCCTTTGTCAAC -3'
(R):5'- AAGTACCATCTGTCTCTGCCTG -3'

Sequencing Primer
(F):5'- GCAGGCCTTTGTCAACATGACC -3'
(R):5'- CTGCTTTGGCCCAAGGATG -3'

Posted On

2015-07-07