Incidental Mutation 'R4355:Prkg1'
ID327525
Institutional Source Beutler Lab
Gene Symbol Prkg1
Ensembl Gene ENSMUSG00000052920
Gene Nameprotein kinase, cGMP-dependent, type I
SynonymsPrkgr1b, Prkg1b
MMRRC Submission 041108-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.635) question?
Stock #R4355 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location30567551-31765033 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to G at 30569229 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000073268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065067] [ENSMUST00000073581]
Predicted Effect probably benign
Transcript: ENSMUST00000065067
SMART Domains Protein: ENSMUSP00000067576
Gene: ENSMUSG00000052920

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
cNMP 103 216 6.37e-27 SMART
cNMP 221 343 1.23e-33 SMART
S_TKc 360 619 5.25e-91 SMART
S_TK_X 620 671 1.55e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073581
SMART Domains Protein: ENSMUSP00000073268
Gene: ENSMUSG00000052920

DomainStartEndE-ValueType
coiled coil region 10 62 N/A INTRINSIC
cNMP 118 231 6.37e-27 SMART
cNMP 236 358 1.23e-33 SMART
S_TKc 375 634 5.25e-91 SMART
S_TK_X 635 686 1.55e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183135
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammals have three different isoforms of cyclic GMP-dependent protein kinase (Ialpha, Ibeta, and II). These PRKG isoforms act as key mediators of the nitric oxide/cGMP signaling pathway and are important components of many signal transduction processes in diverse cell types. This PRKG1 gene on human chromosome 10 encodes the soluble Ialpha and Ibeta isoforms of PRKG by alternative transcript splicing. A separate gene on human chromosome 4, PRKG2, encodes the membrane-bound PRKG isoform II. The PRKG1 proteins play a central role in regulating cardiovascular and neuronal functions in addition to relaxing smooth muscle tone, preventing platelet aggregation, and modulating cell growth. This gene is most strongly expressed in all types of smooth muscle, platelets, cerebellar Purkinje cells, hippocampal neurons, and the lateral amygdala. Isoforms Ialpha and Ibeta have identical cGMP-binding and catalytic domains but differ in their leucine/isoleucine zipper and autoinhibitory sequences and therefore differ in their dimerization substrates and kinase enzyme activity. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutant mice exhibit abnormal smooth muscle function and penile erectile deficiency. Conditional disruption in the hippocampus results in impaired LTP. Mice homozygous for a transposon induced allele exhibit postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a T G 8: 43,570,185 Q89H probably benign Het
Adgrb1 T C 15: 74,543,662 F697S probably damaging Het
Adgrl2 A T 3: 148,839,152 V769E probably damaging Het
Aldh7a1 A T 18: 56,548,494 F173L probably null Het
Arntl A G 7: 113,303,406 I421V possibly damaging Het
Bcl3 G T 7: 19,811,580 C208* probably null Het
Casz1 T C 4: 148,952,335 S1685P unknown Het
Cep250 A G 2: 155,991,525 E1789G probably damaging Het
Cep76 A T 18: 67,626,640 D334E probably benign Het
Clca3b A T 3: 144,825,458 probably null Het
Col9a3 A G 2: 180,606,478 S208G probably benign Het
Ddx47 T C 6: 135,021,505 V388A probably benign Het
Dync1h1 C T 12: 110,632,899 A1896V possibly damaging Het
Eif2ak2 T A 17: 78,858,534 R411S probably benign Het
F7 A G 8: 13,034,774 T267A probably benign Het
Fras1 C A 5: 96,700,242 D1770E probably benign Het
G2e3 T A 12: 51,365,337 Y387N probably benign Het
Hspg2 C T 4: 137,529,418 L1491F probably damaging Het
Ighv3-4 T C 12: 114,253,640 I110M probably benign Het
Itgb5 T A 16: 33,844,997 C28S probably damaging Het
Kbtbd11 C A 8: 15,028,578 N392K probably damaging Het
Kcnmb4 A G 10: 116,473,284 S80P possibly damaging Het
Kif21a C T 15: 90,970,833 C721Y probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klrc3 T C 6: 129,639,162 M189V probably benign Het
Macf1 T A 4: 123,475,091 E394V possibly damaging Het
Mrgprb4 C T 7: 48,198,701 G160R possibly damaging Het
Myb A G 10: 21,152,617 S116P probably damaging Het
Nf2 G A 11: 4,780,613 Q513* probably null Het
Nmnat3 C T 9: 98,410,152 T150M possibly damaging Het
Olfr361 C A 2: 37,084,930 V273F probably benign Het
Olfr743 T C 14: 50,533,759 C116R possibly damaging Het
Patj T G 4: 98,650,454 C210W possibly damaging Het
Pde3b A G 7: 114,416,287 H246R probably benign Het
Pnp2 A G 14: 50,959,625 H56R probably benign Het
Rhbdf1 C T 11: 32,216,236 S8N probably damaging Het
Rimbp3 A G 16: 17,209,692 K327E possibly damaging Het
Rnf219 A G 14: 104,479,257 V560A probably benign Het
Rsph6a T A 7: 19,067,078 probably null Het
Ryr2 T C 13: 11,649,812 N3535S probably benign Het
Ssfa2 A G 2: 79,641,998 N132S probably benign Het
Ston1 T G 17: 88,637,008 V614G probably damaging Het
Svep1 T A 4: 58,138,695 T466S possibly damaging Het
Tas2r109 A T 6: 132,980,181 I262N probably benign Het
Tmtc1 T C 6: 148,355,098 probably benign Het
Tshz2 G A 2: 169,884,938 E16K possibly damaging Het
Ufsp2 T A 8: 45,985,465 S193R possibly damaging Het
Ugt2b5 C A 5: 87,139,763 E182* probably null Het
Usp43 A G 11: 67,891,464 V376A probably benign Het
Utp15 A T 13: 98,259,247 F76I possibly damaging Het
Wdr62 A C 7: 30,242,248 L1141R probably damaging Het
Zfp418 T A 7: 7,172,162 M18K probably benign Het
Other mutations in Prkg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Prkg1 APN 19 31302340 missense probably benign 0.02
IGL00481:Prkg1 APN 19 30571622 missense probably benign 0.28
IGL00517:Prkg1 APN 19 30894668 missense probably benign
IGL00782:Prkg1 APN 19 30578753 splice site probably benign
IGL01070:Prkg1 APN 19 30569343 splice site probably benign
IGL01106:Prkg1 APN 19 30585278 missense probably benign 0.05
IGL01783:Prkg1 APN 19 30624689 missense probably damaging 1.00
IGL02135:Prkg1 APN 19 30993076 missense probably benign 0.13
IGL02492:Prkg1 APN 19 30724202 missense probably damaging 1.00
IGL02543:Prkg1 APN 19 30624734 missense possibly damaging 0.62
IGL02733:Prkg1 APN 19 31302301 missense probably damaging 1.00
IGL03129:Prkg1 APN 19 30585281 nonsense probably null
IGL03220:Prkg1 APN 19 30569237 utr 3 prime probably benign
R0363:Prkg1 UTSW 19 31664196 missense probably damaging 1.00
R0693:Prkg1 UTSW 19 30594978 missense probably benign
R1099:Prkg1 UTSW 19 30571612 missense probably benign
R1464:Prkg1 UTSW 19 30578870 missense probably damaging 0.99
R1464:Prkg1 UTSW 19 30578870 missense probably damaging 0.99
R1556:Prkg1 UTSW 19 30624743 missense probably benign
R1738:Prkg1 UTSW 19 30786922 missense possibly damaging 0.48
R1974:Prkg1 UTSW 19 31585695 missense probably damaging 1.00
R2011:Prkg1 UTSW 19 31664142 missense possibly damaging 0.94
R2207:Prkg1 UTSW 19 30578860 missense probably damaging 1.00
R2270:Prkg1 UTSW 19 30578631 missense probably benign 0.27
R3009:Prkg1 UTSW 19 31664112 missense possibly damaging 0.74
R4078:Prkg1 UTSW 19 31585578 missense probably damaging 1.00
R4652:Prkg1 UTSW 19 30595012 missense probably damaging 1.00
R4669:Prkg1 UTSW 19 31664239 missense probably damaging 0.98
R4684:Prkg1 UTSW 19 31664179 nonsense probably null
R4789:Prkg1 UTSW 19 31585645 missense probably damaging 0.97
R4826:Prkg1 UTSW 19 31764606 missense possibly damaging 0.93
R4936:Prkg1 UTSW 19 30586375 missense probably benign 0.37
R5625:Prkg1 UTSW 19 31764762 missense possibly damaging 0.95
R5819:Prkg1 UTSW 19 31585672 missense probably benign 0.02
R5855:Prkg1 UTSW 19 30894694 missense possibly damaging 0.93
R5882:Prkg1 UTSW 19 31585697 missense probably damaging 1.00
R5965:Prkg1 UTSW 19 30724156 splice site probably null
R5968:Prkg1 UTSW 19 30592924 missense probably damaging 1.00
R6310:Prkg1 UTSW 19 30569251 missense probably damaging 1.00
R6433:Prkg1 UTSW 19 30781346 missense probably benign 0.21
R6702:Prkg1 UTSW 19 30993084 missense probably benign 0.00
R6750:Prkg1 UTSW 19 31764561 missense probably benign 0.41
R6894:Prkg1 UTSW 19 30624774 nonsense probably null
R7155:Prkg1 UTSW 19 31302301 missense probably damaging 1.00
R7165:Prkg1 UTSW 19 30585199 missense probably damaging 1.00
R7238:Prkg1 UTSW 19 30624690 missense probably damaging 1.00
R7428:Prkg1 UTSW 19 30578835 missense probably damaging 1.00
R7748:Prkg1 UTSW 19 30993091 missense possibly damaging 0.90
R7804:Prkg1 UTSW 19 30578632 missense probably benign 0.00
R7804:Prkg1 UTSW 19 30624770 missense possibly damaging 0.92
R7893:Prkg1 UTSW 19 30586367 missense probably damaging 0.99
R8304:Prkg1 UTSW 19 30724184 missense possibly damaging 0.75
X0011:Prkg1 UTSW 19 30993121 missense probably damaging 1.00
Z1177:Prkg1 UTSW 19 31302373 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTCAGGACCACCATGTCAACTG -3'
(R):5'- TAAAATCTCTAGGTCACAGTTCTGC -3'

Sequencing Primer
(F):5'- GACCACCATGTCAACTGCTATTTTAG -3'
(R):5'- TAGGTCACAGTTCTGCCCAAATC -3'
Posted On2015-07-07