Incidental Mutation 'R4355:Prkg1'
ID 327525
Institutional Source Beutler Lab
Gene Symbol Prkg1
Ensembl Gene ENSMUSG00000052920
Gene Name protein kinase, cGMP-dependent, type I
Synonyms Prkgr1b, Prkg1b
MMRRC Submission 041108-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.440) question?
Stock # R4355 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 30541889-31742433 bp(-) (GRCm39)
Type of Mutation utr 3 prime
DNA Base Change (assembly) A to G at 30546629 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000073268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065067] [ENSMUST00000073581]
AlphaFold P0C605
Predicted Effect probably benign
Transcript: ENSMUST00000065067
SMART Domains Protein: ENSMUSP00000067576
Gene: ENSMUSG00000052920

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
cNMP 103 216 6.37e-27 SMART
cNMP 221 343 1.23e-33 SMART
S_TKc 360 619 5.25e-91 SMART
S_TK_X 620 671 1.55e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073581
SMART Domains Protein: ENSMUSP00000073268
Gene: ENSMUSG00000052920

DomainStartEndE-ValueType
coiled coil region 10 62 N/A INTRINSIC
cNMP 118 231 6.37e-27 SMART
cNMP 236 358 1.23e-33 SMART
S_TKc 375 634 5.25e-91 SMART
S_TK_X 635 686 1.55e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183135
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammals have three different isoforms of cyclic GMP-dependent protein kinase (Ialpha, Ibeta, and II). These PRKG isoforms act as key mediators of the nitric oxide/cGMP signaling pathway and are important components of many signal transduction processes in diverse cell types. This PRKG1 gene on human chromosome 10 encodes the soluble Ialpha and Ibeta isoforms of PRKG by alternative transcript splicing. A separate gene on human chromosome 4, PRKG2, encodes the membrane-bound PRKG isoform II. The PRKG1 proteins play a central role in regulating cardiovascular and neuronal functions in addition to relaxing smooth muscle tone, preventing platelet aggregation, and modulating cell growth. This gene is most strongly expressed in all types of smooth muscle, platelets, cerebellar Purkinje cells, hippocampal neurons, and the lateral amygdala. Isoforms Ialpha and Ibeta have identical cGMP-binding and catalytic domains but differ in their leucine/isoleucine zipper and autoinhibitory sequences and therefore differ in their dimerization substrates and kinase enzyme activity. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutant mice exhibit abnormal smooth muscle function and penile erectile deficiency. Conditional disruption in the hippocampus results in impaired LTP. Mice homozygous for a transposon induced allele exhibit postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a T G 8: 44,023,222 (GRCm39) Q89H probably benign Het
Adgrb1 T C 15: 74,415,511 (GRCm39) F697S probably damaging Het
Adgrl2 A T 3: 148,544,788 (GRCm39) V769E probably damaging Het
Aldh7a1 A T 18: 56,681,566 (GRCm39) F173L probably null Het
Bcl3 G T 7: 19,545,505 (GRCm39) C208* probably null Het
Bmal1 A G 7: 112,902,613 (GRCm39) I421V possibly damaging Het
Casz1 T C 4: 149,036,792 (GRCm39) S1685P unknown Het
Cep250 A G 2: 155,833,445 (GRCm39) E1789G probably damaging Het
Cep76 A T 18: 67,759,710 (GRCm39) D334E probably benign Het
Clca3b A T 3: 144,531,219 (GRCm39) probably null Het
Col9a3 A G 2: 180,248,271 (GRCm39) S208G probably benign Het
Ddx47 T C 6: 134,998,468 (GRCm39) V388A probably benign Het
Dync1h1 C T 12: 110,599,333 (GRCm39) A1896V possibly damaging Het
Eif2ak2 T A 17: 79,165,963 (GRCm39) R411S probably benign Het
F7 A G 8: 13,084,774 (GRCm39) T267A probably benign Het
Fras1 C A 5: 96,848,101 (GRCm39) D1770E probably benign Het
G2e3 T A 12: 51,412,120 (GRCm39) Y387N probably benign Het
Hspg2 C T 4: 137,256,729 (GRCm39) L1491F probably damaging Het
Ighv3-4 T C 12: 114,217,260 (GRCm39) I110M probably benign Het
Itgb5 T A 16: 33,665,367 (GRCm39) C28S probably damaging Het
Itprid2 A G 2: 79,472,342 (GRCm39) N132S probably benign Het
Kbtbd11 C A 8: 15,078,578 (GRCm39) N392K probably damaging Het
Kcnmb4 A G 10: 116,309,189 (GRCm39) S80P possibly damaging Het
Kif21a C T 15: 90,855,036 (GRCm39) C721Y probably benign Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Klrc3 T C 6: 129,616,125 (GRCm39) M189V probably benign Het
Macf1 T A 4: 123,368,884 (GRCm39) E394V possibly damaging Het
Mrgprb4 C T 7: 47,848,449 (GRCm39) G160R possibly damaging Het
Myb A G 10: 21,028,516 (GRCm39) S116P probably damaging Het
Nf2 G A 11: 4,730,613 (GRCm39) Q513* probably null Het
Nmnat3 C T 9: 98,292,205 (GRCm39) T150M possibly damaging Het
Obi1 A G 14: 104,716,693 (GRCm39) V560A probably benign Het
Or11g27 T C 14: 50,771,216 (GRCm39) C116R possibly damaging Het
Or12k8 C A 2: 36,974,942 (GRCm39) V273F probably benign Het
Patj T G 4: 98,538,691 (GRCm39) C210W possibly damaging Het
Pde3b A G 7: 114,015,522 (GRCm39) H246R probably benign Het
Pnp2 A G 14: 51,197,082 (GRCm39) H56R probably benign Het
Rhbdf1 C T 11: 32,166,236 (GRCm39) S8N probably damaging Het
Rimbp3 A G 16: 17,027,556 (GRCm39) K327E possibly damaging Het
Rsph6a T A 7: 18,801,003 (GRCm39) probably null Het
Ryr2 T C 13: 11,664,698 (GRCm39) N3535S probably benign Het
Ston1 T G 17: 88,944,436 (GRCm39) V614G probably damaging Het
Svep1 T A 4: 58,138,695 (GRCm39) T466S possibly damaging Het
Tas2r109 A T 6: 132,957,144 (GRCm39) I262N probably benign Het
Tmtc1 T C 6: 148,256,596 (GRCm39) probably benign Het
Tshz2 G A 2: 169,726,858 (GRCm39) E16K possibly damaging Het
Ufsp2 T A 8: 46,438,502 (GRCm39) S193R possibly damaging Het
Ugt2b5 C A 5: 87,287,622 (GRCm39) E182* probably null Het
Usp43 A G 11: 67,782,290 (GRCm39) V376A probably benign Het
Utp15 A T 13: 98,395,755 (GRCm39) F76I possibly damaging Het
Wdr62 A C 7: 29,941,673 (GRCm39) L1141R probably damaging Het
Zfp418 T A 7: 7,175,161 (GRCm39) M18K probably benign Het
Other mutations in Prkg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Prkg1 APN 19 31,279,740 (GRCm39) missense probably benign 0.02
IGL00481:Prkg1 APN 19 30,549,022 (GRCm39) missense probably benign 0.28
IGL00517:Prkg1 APN 19 30,872,068 (GRCm39) missense probably benign
IGL00782:Prkg1 APN 19 30,556,153 (GRCm39) splice site probably benign
IGL01070:Prkg1 APN 19 30,546,743 (GRCm39) splice site probably benign
IGL01106:Prkg1 APN 19 30,562,678 (GRCm39) missense probably benign 0.05
IGL01783:Prkg1 APN 19 30,602,089 (GRCm39) missense probably damaging 1.00
IGL02135:Prkg1 APN 19 30,970,476 (GRCm39) missense probably benign 0.13
IGL02492:Prkg1 APN 19 30,701,602 (GRCm39) missense probably damaging 1.00
IGL02543:Prkg1 APN 19 30,602,134 (GRCm39) missense possibly damaging 0.62
IGL02733:Prkg1 APN 19 31,279,701 (GRCm39) missense probably damaging 1.00
IGL03129:Prkg1 APN 19 30,562,681 (GRCm39) nonsense probably null
IGL03220:Prkg1 APN 19 30,546,637 (GRCm39) utr 3 prime probably benign
R0363:Prkg1 UTSW 19 31,641,596 (GRCm39) missense probably damaging 1.00
R0693:Prkg1 UTSW 19 30,572,378 (GRCm39) missense probably benign
R1099:Prkg1 UTSW 19 30,549,012 (GRCm39) missense probably benign
R1464:Prkg1 UTSW 19 30,556,270 (GRCm39) missense probably damaging 0.99
R1464:Prkg1 UTSW 19 30,556,270 (GRCm39) missense probably damaging 0.99
R1556:Prkg1 UTSW 19 30,602,143 (GRCm39) missense probably benign
R1738:Prkg1 UTSW 19 30,764,322 (GRCm39) missense possibly damaging 0.48
R1974:Prkg1 UTSW 19 31,563,095 (GRCm39) missense probably damaging 1.00
R2011:Prkg1 UTSW 19 31,641,542 (GRCm39) missense possibly damaging 0.94
R2207:Prkg1 UTSW 19 30,556,260 (GRCm39) missense probably damaging 1.00
R2270:Prkg1 UTSW 19 30,556,031 (GRCm39) missense probably benign 0.27
R3009:Prkg1 UTSW 19 31,641,512 (GRCm39) missense possibly damaging 0.74
R4078:Prkg1 UTSW 19 31,562,978 (GRCm39) missense probably damaging 1.00
R4652:Prkg1 UTSW 19 30,572,412 (GRCm39) missense probably damaging 1.00
R4669:Prkg1 UTSW 19 31,641,639 (GRCm39) missense probably damaging 0.98
R4684:Prkg1 UTSW 19 31,641,579 (GRCm39) nonsense probably null
R4789:Prkg1 UTSW 19 31,563,045 (GRCm39) missense probably damaging 0.97
R4826:Prkg1 UTSW 19 31,742,006 (GRCm39) missense possibly damaging 0.93
R4936:Prkg1 UTSW 19 30,563,775 (GRCm39) missense probably benign 0.37
R5625:Prkg1 UTSW 19 31,742,162 (GRCm39) missense possibly damaging 0.95
R5819:Prkg1 UTSW 19 31,563,072 (GRCm39) missense probably benign 0.02
R5855:Prkg1 UTSW 19 30,872,094 (GRCm39) missense possibly damaging 0.93
R5882:Prkg1 UTSW 19 31,563,097 (GRCm39) missense probably damaging 1.00
R5965:Prkg1 UTSW 19 30,701,556 (GRCm39) splice site probably null
R5968:Prkg1 UTSW 19 30,570,324 (GRCm39) missense probably damaging 1.00
R6310:Prkg1 UTSW 19 30,546,651 (GRCm39) missense probably damaging 1.00
R6433:Prkg1 UTSW 19 30,758,746 (GRCm39) missense probably benign 0.21
R6702:Prkg1 UTSW 19 30,970,484 (GRCm39) missense probably benign 0.00
R6750:Prkg1 UTSW 19 31,741,961 (GRCm39) missense probably benign 0.41
R6894:Prkg1 UTSW 19 30,602,174 (GRCm39) nonsense probably null
R7155:Prkg1 UTSW 19 31,279,701 (GRCm39) missense probably damaging 1.00
R7165:Prkg1 UTSW 19 30,562,599 (GRCm39) missense probably damaging 1.00
R7238:Prkg1 UTSW 19 30,602,090 (GRCm39) missense probably damaging 1.00
R7428:Prkg1 UTSW 19 30,556,235 (GRCm39) missense probably damaging 1.00
R7748:Prkg1 UTSW 19 30,970,491 (GRCm39) missense possibly damaging 0.90
R7804:Prkg1 UTSW 19 30,602,170 (GRCm39) missense possibly damaging 0.92
R7804:Prkg1 UTSW 19 30,556,032 (GRCm39) missense probably benign 0.00
R7893:Prkg1 UTSW 19 30,563,767 (GRCm39) missense probably damaging 0.99
R8304:Prkg1 UTSW 19 30,701,584 (GRCm39) missense possibly damaging 0.75
R8497:Prkg1 UTSW 19 31,279,709 (GRCm39) missense probably damaging 1.00
R8676:Prkg1 UTSW 19 31,742,146 (GRCm39) missense probably damaging 0.98
R9318:Prkg1 UTSW 19 30,549,038 (GRCm39) missense probably benign 0.09
R9694:Prkg1 UTSW 19 30,764,371 (GRCm39) missense possibly damaging 0.84
X0011:Prkg1 UTSW 19 30,970,521 (GRCm39) missense probably damaging 1.00
Z1177:Prkg1 UTSW 19 31,279,773 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTCAGGACCACCATGTCAACTG -3'
(R):5'- TAAAATCTCTAGGTCACAGTTCTGC -3'

Sequencing Primer
(F):5'- GACCACCATGTCAACTGCTATTTTAG -3'
(R):5'- TAGGTCACAGTTCTGCCCAAATC -3'
Posted On 2015-07-07