Mutagenetix > Incidental Mutation

Incidental Mutation 'R4355:Prkg1'

327525

Institutional Source

Beutler Lab

Gene Symbol

Prkg1

Ensembl Gene

ENSMUSG00000052920

Gene Name

protein kinase, cGMP-dependent, type I

Synonyms

Prkgr1b, Prkg1b

MMRRC Submission

041108-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.516) question?

Stock #

R4355 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30567551-31765033 bp(-) (GRCm38)

Type of Mutation

utr 3 prime

DNA Base Change (assembly)

A to G at 30569229 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000073268 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065067] [ENSMUST00000073581]

AlphaFold

P0C605

Predicted Effect

probably benign
Transcript: ENSMUST00000065067

SMART Domains

Protein: ENSMUSP00000067576
Gene: ENSMUSG00000052920

Domain	Start	End	E-Value	Type
coiled coil region	5	49	N/A	INTRINSIC
cNMP	103	216	6.37e-27	SMART
cNMP	221	343	1.23e-33	SMART
S_TKc	360	619	5.25e-91	SMART
S_TK_X	620	671	1.55e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000073581

SMART Domains

Protein: ENSMUSP00000073268
Gene: ENSMUSG00000052920

Domain	Start	End	E-Value	Type
coiled coil region	10	62	N/A	INTRINSIC
cNMP	118	231	6.37e-27	SMART
cNMP	236	358	1.23e-33	SMART
S_TKc	375	634	5.25e-91	SMART
S_TK_X	635	686	1.55e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182459

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183135

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammals have three different isoforms of cyclic GMP-dependent protein kinase (Ialpha, Ibeta, and II). These PRKG isoforms act as key mediators of the nitric oxide/cGMP signaling pathway and are important components of many signal transduction processes in diverse cell types. This PRKG1 gene on human chromosome 10 encodes the soluble Ialpha and Ibeta isoforms of PRKG by alternative transcript splicing. A separate gene on human chromosome 4, PRKG2, encodes the membrane-bound PRKG isoform II. The PRKG1 proteins play a central role in regulating cardiovascular and neuronal functions in addition to relaxing smooth muscle tone, preventing platelet aggregation, and modulating cell growth. This gene is most strongly expressed in all types of smooth muscle, platelets, cerebellar Purkinje cells, hippocampal neurons, and the lateral amygdala. Isoforms Ialpha and Ibeta have identical cGMP-binding and catalytic domains but differ in their leucine/isoleucine zipper and autoinhibitory sequences and therefore differ in their dimerization substrates and kinase enzyme activity. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutant mice exhibit abnormal smooth muscle function and penile erectile deficiency. Conditional disruption in the hippocampus results in impaired LTP. Mice homozygous for a transposon induced allele exhibit postnatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam26a	T	G	8: 43,570,185	Q89H	probably benign	Het
Adgrb1	T	C	15: 74,543,662	F697S	probably damaging	Het
Adgrl2	A	T	3: 148,839,152	V769E	probably damaging	Het
Aldh7a1	A	T	18: 56,548,494	F173L	probably null	Het
Arntl	A	G	7: 113,303,406	I421V	possibly damaging	Het
Bcl3	G	T	7: 19,811,580	C208*	probably null	Het
Casz1	T	C	4: 148,952,335	S1685P	unknown	Het
Cep250	A	G	2: 155,991,525	E1789G	probably damaging	Het
Cep76	A	T	18: 67,626,640	D334E	probably benign	Het
Clca3b	A	T	3: 144,825,458		probably null	Het
Col9a3	A	G	2: 180,606,478	S208G	probably benign	Het
Ddx47	T	C	6: 135,021,505	V388A	probably benign	Het
Dync1h1	C	T	12: 110,632,899	A1896V	possibly damaging	Het
Eif2ak2	T	A	17: 78,858,534	R411S	probably benign	Het
F7	A	G	8: 13,034,774	T267A	probably benign	Het
Fras1	C	A	5: 96,700,242	D1770E	probably benign	Het
G2e3	T	A	12: 51,365,337	Y387N	probably benign	Het
Hspg2	C	T	4: 137,529,418	L1491F	probably damaging	Het
Ighv3-4	T	C	12: 114,253,640	I110M	probably benign	Het
Itgb5	T	A	16: 33,844,997	C28S	probably damaging	Het
Kbtbd11	C	A	8: 15,028,578	N392K	probably damaging	Het
Kcnmb4	A	G	10: 116,473,284	S80P	possibly damaging	Het
Kif21a	C	T	15: 90,970,833	C721Y	probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Klrc3	T	C	6: 129,639,162	M189V	probably benign	Het
Macf1	T	A	4: 123,475,091	E394V	possibly damaging	Het
Mrgprb4	C	T	7: 48,198,701	G160R	possibly damaging	Het
Myb	A	G	10: 21,152,617	S116P	probably damaging	Het
Nf2	G	A	11: 4,780,613	Q513*	probably null	Het
Nmnat3	C	T	9: 98,410,152	T150M	possibly damaging	Het
Olfr361	C	A	2: 37,084,930	V273F	probably benign	Het
Olfr743	T	C	14: 50,533,759	C116R	possibly damaging	Het
Patj	T	G	4: 98,650,454	C210W	possibly damaging	Het
Pde3b	A	G	7: 114,416,287	H246R	probably benign	Het
Pnp2	A	G	14: 50,959,625	H56R	probably benign	Het
Rhbdf1	C	T	11: 32,216,236	S8N	probably damaging	Het
Rimbp3	A	G	16: 17,209,692	K327E	possibly damaging	Het
Rnf219	A	G	14: 104,479,257	V560A	probably benign	Het
Rsph6a	T	A	7: 19,067,078		probably null	Het
Ryr2	T	C	13: 11,649,812	N3535S	probably benign	Het
Ssfa2	A	G	2: 79,641,998	N132S	probably benign	Het
Ston1	T	G	17: 88,637,008	V614G	probably damaging	Het
Svep1	T	A	4: 58,138,695	T466S	possibly damaging	Het
Tas2r109	A	T	6: 132,980,181	I262N	probably benign	Het
Tmtc1	T	C	6: 148,355,098		probably benign	Het
Tshz2	G	A	2: 169,884,938	E16K	possibly damaging	Het
Ufsp2	T	A	8: 45,985,465	S193R	possibly damaging	Het
Ugt2b5	C	A	5: 87,139,763	E182*	probably null	Het
Usp43	A	G	11: 67,891,464	V376A	probably benign	Het
Utp15	A	T	13: 98,259,247	F76I	possibly damaging	Het
Wdr62	A	C	7: 30,242,248	L1141R	probably damaging	Het
Zfp418	T	A	7: 7,172,162	M18K	probably benign	Het

Other mutations in Prkg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Prkg1	APN	19	31302340	missense	probably benign	0.02
IGL00481:Prkg1	APN	19	30571622	missense	probably benign	0.28
IGL00517:Prkg1	APN	19	30894668	missense	probably benign
IGL00782:Prkg1	APN	19	30578753	splice site	probably benign
IGL01070:Prkg1	APN	19	30569343	splice site	probably benign
IGL01106:Prkg1	APN	19	30585278	missense	probably benign	0.05
IGL01783:Prkg1	APN	19	30624689	missense	probably damaging	1.00
IGL02135:Prkg1	APN	19	30993076	missense	probably benign	0.13
IGL02492:Prkg1	APN	19	30724202	missense	probably damaging	1.00
IGL02543:Prkg1	APN	19	30624734	missense	possibly damaging	0.62
IGL02733:Prkg1	APN	19	31302301	missense	probably damaging	1.00
IGL03129:Prkg1	APN	19	30585281	nonsense	probably null
IGL03220:Prkg1	APN	19	30569237	utr 3 prime	probably benign
R0363:Prkg1	UTSW	19	31664196	missense	probably damaging	1.00
R0693:Prkg1	UTSW	19	30594978	missense	probably benign
R1099:Prkg1	UTSW	19	30571612	missense	probably benign
R1464:Prkg1	UTSW	19	30578870	missense	probably damaging	0.99
R1464:Prkg1	UTSW	19	30578870	missense	probably damaging	0.99
R1556:Prkg1	UTSW	19	30624743	missense	probably benign
R1738:Prkg1	UTSW	19	30786922	missense	possibly damaging	0.48
R1974:Prkg1	UTSW	19	31585695	missense	probably damaging	1.00
R2011:Prkg1	UTSW	19	31664142	missense	possibly damaging	0.94
R2207:Prkg1	UTSW	19	30578860	missense	probably damaging	1.00
R2270:Prkg1	UTSW	19	30578631	missense	probably benign	0.27
R3009:Prkg1	UTSW	19	31664112	missense	possibly damaging	0.74
R4078:Prkg1	UTSW	19	31585578	missense	probably damaging	1.00
R4652:Prkg1	UTSW	19	30595012	missense	probably damaging	1.00
R4669:Prkg1	UTSW	19	31664239	missense	probably damaging	0.98
R4684:Prkg1	UTSW	19	31664179	nonsense	probably null
R4789:Prkg1	UTSW	19	31585645	missense	probably damaging	0.97
R4826:Prkg1	UTSW	19	31764606	missense	possibly damaging	0.93
R4936:Prkg1	UTSW	19	30586375	missense	probably benign	0.37
R5625:Prkg1	UTSW	19	31764762	missense	possibly damaging	0.95
R5819:Prkg1	UTSW	19	31585672	missense	probably benign	0.02
R5855:Prkg1	UTSW	19	30894694	missense	possibly damaging	0.93
R5882:Prkg1	UTSW	19	31585697	missense	probably damaging	1.00
R5965:Prkg1	UTSW	19	30724156	splice site	probably null
R5968:Prkg1	UTSW	19	30592924	missense	probably damaging	1.00
R6310:Prkg1	UTSW	19	30569251	missense	probably damaging	1.00
R6433:Prkg1	UTSW	19	30781346	missense	probably benign	0.21
R6702:Prkg1	UTSW	19	30993084	missense	probably benign	0.00
R6750:Prkg1	UTSW	19	31764561	missense	probably benign	0.41
R6894:Prkg1	UTSW	19	30624774	nonsense	probably null
R7155:Prkg1	UTSW	19	31302301	missense	probably damaging	1.00
R7165:Prkg1	UTSW	19	30585199	missense	probably damaging	1.00
R7238:Prkg1	UTSW	19	30624690	missense	probably damaging	1.00
R7428:Prkg1	UTSW	19	30578835	missense	probably damaging	1.00
R7748:Prkg1	UTSW	19	30993091	missense	possibly damaging	0.90
R7804:Prkg1	UTSW	19	30578632	missense	probably benign	0.00
R7804:Prkg1	UTSW	19	30624770	missense	possibly damaging	0.92
R7893:Prkg1	UTSW	19	30586367	missense	probably damaging	0.99
R8304:Prkg1	UTSW	19	30724184	missense	possibly damaging	0.75
R8497:Prkg1	UTSW	19	31302309	missense	probably damaging	1.00
R8676:Prkg1	UTSW	19	31764746	missense	probably damaging	0.98
R9318:Prkg1	UTSW	19	30571638	missense	probably benign	0.09
R9694:Prkg1	UTSW	19	30786971	missense	possibly damaging	0.84
X0011:Prkg1	UTSW	19	30993121	missense	probably damaging	1.00
Z1177:Prkg1	UTSW	19	31302373	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TTCAGGACCACCATGTCAACTG -3'
(R):5'- TAAAATCTCTAGGTCACAGTTCTGC -3'

Sequencing Primer
(F):5'- GACCACCATGTCAACTGCTATTTTAG -3'
(R):5'- TAGGTCACAGTTCTGCCCAAATC -3'

Posted On

2015-07-07