Incidental Mutation 'R4356:Rbm19'
ID327542
Institutional Source Beutler Lab
Gene Symbol Rbm19
Ensembl Gene ENSMUSG00000029594
Gene NameRNA binding motif protein 19
Synonyms1200009A02Rik
MMRRC Submission 041669-MU
Accession Numbers

Genbank: NM_028762 ; MGI: 1921361

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4356 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location120116465-120198981 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120140362 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 737 (T737A)
Ref Sequence ENSEMBL: ENSMUSP00000144339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031590] [ENSMUST00000202777]
Predicted Effect probably benign
Transcript: ENSMUST00000031590
AA Change: T737A

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000031590
Gene: ENSMUSG00000029594
AA Change: T737A

DomainStartEndE-ValueType
RRM 3 75 7.64e-20 SMART
Pfam:RRM_u2 81 277 1.7e-10 PFAM
RRM 294 364 9.14e-9 SMART
RRM 401 474 6.4e-22 SMART
RRM 585 652 1.6e-4 SMART
coiled coil region 694 717 N/A INTRINSIC
RRM 723 799 4.59e-23 SMART
RRM 825 900 9.4e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181905
Predicted Effect possibly damaging
Transcript: ENSMUST00000202777
AA Change: T737A

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000144339
Gene: ENSMUSG00000029594
AA Change: T737A

DomainStartEndE-ValueType
RRM 3 75 3.3e-22 SMART
Pfam:RRM_u2 81 269 1.2e-6 PFAM
RRM 294 364 3.9e-11 SMART
RRM 401 474 2.7e-24 SMART
RRM 585 652 7e-7 SMART
coiled coil region 694 717 N/A INTRINSIC
RRM 723 799 2e-25 SMART
Pfam:RRM_6 826 865 1.1e-3 PFAM
Pfam:RRM_1 826 870 8.5e-6 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar protein that contains six RNA-binding motifs. The encoded protein may be involved in regulating ribosome biogenesis. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit failure to undergo compaction, growth arrest at the morula stage, and apoptosis such that no embryos are observed at E6.5. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 T C 12: 81,558,820 T723A probably damaging Het
Alox5 C T 6: 116,420,258 V322I probably benign Het
Alpk1 C T 3: 127,729,373 V7M probably damaging Het
Ankhd1 A T 18: 36,643,043 K1482* probably null Het
C130079G13Rik T A 3: 59,936,280 Y132N probably damaging Het
Cacna1e A C 1: 154,443,981 D1324E probably damaging Het
Ccdc150 A G 1: 54,353,054 D657G probably damaging Het
Celsr1 A G 15: 85,978,827 S1335P probably damaging Het
Cspg5 A G 9: 110,256,177 D391G probably damaging Het
Defa30 A T 8: 21,134,805 D48V possibly damaging Het
E2f7 T C 10: 110,759,851 Y136H probably damaging Het
Fbxw25 A T 9: 109,662,085 C122S probably damaging Het
Fgg A T 3: 83,012,943 D343V probably damaging Het
Flnb T A 14: 7,922,700 M1712K probably benign Het
Fnbp4 T C 2: 90,758,339 S485P probably damaging Het
Ftsj3 G A 11: 106,253,676 A134V probably benign Het
Gast C A 11: 100,336,547 S22Y probably damaging Het
Gm20834 T A Y: 10,322,962 H158L possibly damaging Het
Gm4788 T A 1: 139,732,310 K621N probably damaging Het
Ids C A X: 70,346,344 G506C probably damaging Het
Ifna15 G T 4: 88,557,842 T135N probably benign Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Impg2 C T 16: 56,260,164 T777I probably damaging Het
Kif11 C A 19: 37,411,435 T790K probably benign Het
Kif24 A G 4: 41,413,827 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrp10 C T 14: 54,468,366 R338C probably damaging Het
Mib1 A G 18: 10,751,844 N242S probably benign Het
Nectin1 A G 9: 43,792,505 D264G probably benign Het
Nipsnap3a T C 4: 52,995,979 probably null Het
Oit1 A G 14: 8,349,314 L212P probably damaging Het
Olfr1137 G A 2: 87,711,885 S7F possibly damaging Het
Olfr119 G T 17: 37,700,899 E76D probably damaging Het
P3h4 A G 11: 100,413,626 F263S probably damaging Het
Pcdhga4 C T 18: 37,687,611 H738Y probably damaging Het
Prickle2 A T 6: 92,411,509 I304K probably damaging Het
Ptprq A T 10: 107,608,364 Y1460N probably damaging Het
Rbl2 A G 8: 91,107,107 D812G probably damaging Het
Rbsn G A 6: 92,207,048 L95F possibly damaging Het
Sall4 T C 2: 168,755,480 E480G probably benign Het
Scfd1 T A 12: 51,439,285 N541K probably benign Het
Scube3 G A 17: 28,164,309 G442S probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Smarcc1 A G 9: 110,196,256 D667G probably damaging Het
Sned1 A T 1: 93,265,391 probably null Het
Spsb1 T C 4: 149,906,775 H112R probably damaging Het
Sun3 A G 11: 9,016,328 V231A probably damaging Het
Vmn2r106 A T 17: 20,279,648 D108E probably benign Het
Xdh A G 17: 73,915,690 V560A probably benign Het
Zfp352 T A 4: 90,223,834 H70Q possibly damaging Het
Zfp40 C A 17: 23,177,190 C73F probably benign Het
Zfp975 A C 7: 42,661,827 L454R probably damaging Het
Zik1 A T 7: 10,490,341 C276* probably null Het
Other mutations in Rbm19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Rbm19 APN 5 120143438 splice site probably benign
IGL01750:Rbm19 APN 5 120118792 missense probably benign 0.00
IGL01830:Rbm19 APN 5 120124695 missense possibly damaging 0.95
IGL02028:Rbm19 APN 5 120120236 missense probably damaging 1.00
IGL02262:Rbm19 APN 5 120143405 missense probably damaging 0.99
IGL03030:Rbm19 APN 5 120131246 missense probably damaging 1.00
IGL03094:Rbm19 APN 5 120122958 missense probably damaging 1.00
N/A:Rbm19 UTSW 5 120144097 missense probably damaging 0.99
PIT4812001:Rbm19 UTSW 5 120128250 missense possibly damaging 0.91
R0190:Rbm19 UTSW 5 120144046 missense probably benign 0.30
R0350:Rbm19 UTSW 5 120128307 missense possibly damaging 0.75
R0594:Rbm19 UTSW 5 120128316 critical splice donor site probably null
R0924:Rbm19 UTSW 5 120126204 missense probably benign 0.11
R0930:Rbm19 UTSW 5 120126204 missense probably benign 0.11
R0963:Rbm19 UTSW 5 120130734 missense possibly damaging 0.83
R1144:Rbm19 UTSW 5 120123016 missense possibly damaging 0.87
R1438:Rbm19 UTSW 5 120122896 missense probably benign 0.01
R1441:Rbm19 UTSW 5 120131176 missense probably damaging 1.00
R1458:Rbm19 UTSW 5 120144029 missense probably benign 0.00
R1518:Rbm19 UTSW 5 120140280 small deletion probably benign
R1992:Rbm19 UTSW 5 120133883 critical splice donor site probably null
R2029:Rbm19 UTSW 5 120120242 missense possibly damaging 0.85
R3055:Rbm19 UTSW 5 120133010 missense probably damaging 1.00
R4808:Rbm19 UTSW 5 120118774 missense probably damaging 0.99
R4817:Rbm19 UTSW 5 120133734 intron probably benign
R4857:Rbm19 UTSW 5 120132833 splice site probably benign
R4963:Rbm19 UTSW 5 120141566 missense probably damaging 1.00
R5812:Rbm19 UTSW 5 120141577 missense probably damaging 1.00
R5857:Rbm19 UTSW 5 120132942 missense probably damaging 1.00
R5878:Rbm19 UTSW 5 120132867 missense probably damaging 1.00
R5976:Rbm19 UTSW 5 120140307 missense probably benign 0.01
R6345:Rbm19 UTSW 5 120127040 missense possibly damaging 0.87
R6489:Rbm19 UTSW 5 120120130 missense probably benign 0.06
R6495:Rbm19 UTSW 5 120119680 missense probably damaging 1.00
R7081:Rbm19 UTSW 5 120123151 critical splice donor site probably null
R7181:Rbm19 UTSW 5 120116467 unclassified probably benign
R7307:Rbm19 UTSW 5 120186218 missense possibly damaging 0.55
R8058:Rbm19 UTSW 5 120140375 critical splice donor site probably null
R8432:Rbm19 UTSW 5 120175926 missense probably damaging 1.00
R8696:Rbm19 UTSW 5 120127067 missense probably damaging 0.98
R8910:Rbm19 UTSW 5 120133779 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAGTTTGCAGTGTCACCATG -3'
(R):5'- CCCACTTTGGAAAACACCTG -3'

Sequencing Primer
(F):5'- TGCAGTGTCACCATGTAACG -3'
(R):5'- CTTTGGAAAACACCTGCAAAAG -3'
Posted On2015-07-07