Incidental Mutation 'R4356:Rbsn'
ID327544
Institutional Source Beutler Lab
Gene Symbol Rbsn
Ensembl Gene ENSMUSG00000014550
Gene Namerabenosyn, RAB effector
Synonyms5330426D11Rik, Rabenosyn-5, Zfyve20
MMRRC Submission 041669-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4356 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location92186712-92214925 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 92207048 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 95 (L95F)
Ref Sequence ENSEMBL: ENSMUSP00000014694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014694] [ENSMUST00000138041] [ENSMUST00000203516]
Predicted Effect possibly damaging
Transcript: ENSMUST00000014694
AA Change: L95F

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000014694
Gene: ENSMUSG00000014550
AA Change: L95F

DomainStartEndE-ValueType
ZnF_C2H2 14 37 4.45e0 SMART
low complexity region 53 64 N/A INTRINSIC
FYVE 148 260 2e-10 SMART
coiled coil region 377 412 N/A INTRINSIC
Pfam:Rbsn 457 498 9e-21 PFAM
low complexity region 512 535 N/A INTRINSIC
Pfam:NPF 547 736 2.3e-61 PFAM
Pfam:Rbsn 737 778 6.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138041
Predicted Effect probably benign
Transcript: ENSMUST00000203516
Meta Mutation Damage Score 0.0619 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the FYVE zinc finger family of proteins. The encoded protein interacts with Ras-related proteins that regulate membrane trafficking. A missense mutation in this gene is associated with a defect in the early endocytic pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 T C 12: 81,558,820 T723A probably damaging Het
Alox5 C T 6: 116,420,258 V322I probably benign Het
Alpk1 C T 3: 127,729,373 V7M probably damaging Het
Ankhd1 A T 18: 36,643,043 K1482* probably null Het
C130079G13Rik T A 3: 59,936,280 Y132N probably damaging Het
Cacna1e A C 1: 154,443,981 D1324E probably damaging Het
Ccdc150 A G 1: 54,353,054 D657G probably damaging Het
Celsr1 A G 15: 85,978,827 S1335P probably damaging Het
Cspg5 A G 9: 110,256,177 D391G probably damaging Het
Defa30 A T 8: 21,134,805 D48V possibly damaging Het
E2f7 T C 10: 110,759,851 Y136H probably damaging Het
Fbxw25 A T 9: 109,662,085 C122S probably damaging Het
Fgg A T 3: 83,012,943 D343V probably damaging Het
Flnb T A 14: 7,922,700 M1712K probably benign Het
Fnbp4 T C 2: 90,758,339 S485P probably damaging Het
Ftsj3 G A 11: 106,253,676 A134V probably benign Het
Gast C A 11: 100,336,547 S22Y probably damaging Het
Gm20834 T A Y: 10,322,962 H158L possibly damaging Het
Gm4788 T A 1: 139,732,310 K621N probably damaging Het
Ids C A X: 70,346,344 G506C probably damaging Het
Ifna15 G T 4: 88,557,842 T135N probably benign Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Impg2 C T 16: 56,260,164 T777I probably damaging Het
Kif11 C A 19: 37,411,435 T790K probably benign Het
Kif24 A G 4: 41,413,827 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrp10 C T 14: 54,468,366 R338C probably damaging Het
Mib1 A G 18: 10,751,844 N242S probably benign Het
Nectin1 A G 9: 43,792,505 D264G probably benign Het
Nipsnap3a T C 4: 52,995,979 probably null Het
Oit1 A G 14: 8,349,314 L212P probably damaging Het
Olfr1137 G A 2: 87,711,885 S7F possibly damaging Het
Olfr119 G T 17: 37,700,899 E76D probably damaging Het
P3h4 A G 11: 100,413,626 F263S probably damaging Het
Pcdhga4 C T 18: 37,687,611 H738Y probably damaging Het
Prickle2 A T 6: 92,411,509 I304K probably damaging Het
Ptprq A T 10: 107,608,364 Y1460N probably damaging Het
Rbl2 A G 8: 91,107,107 D812G probably damaging Het
Rbm19 A G 5: 120,140,362 T737A possibly damaging Het
Sall4 T C 2: 168,755,480 E480G probably benign Het
Scfd1 T A 12: 51,439,285 N541K probably benign Het
Scube3 G A 17: 28,164,309 G442S probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Smarcc1 A G 9: 110,196,256 D667G probably damaging Het
Sned1 A T 1: 93,265,391 probably null Het
Spsb1 T C 4: 149,906,775 H112R probably damaging Het
Sun3 A G 11: 9,016,328 V231A probably damaging Het
Vmn2r106 A T 17: 20,279,648 D108E probably benign Het
Xdh A G 17: 73,915,690 V560A probably benign Het
Zfp352 T A 4: 90,223,834 H70Q possibly damaging Het
Zfp40 C A 17: 23,177,190 C73F probably benign Het
Zfp975 A C 7: 42,661,827 L454R probably damaging Het
Zik1 A T 7: 10,490,341 C276* probably null Het
Other mutations in Rbsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01417:Rbsn APN 6 92207119 missense possibly damaging 0.82
IGL02073:Rbsn APN 6 92189359 missense probably damaging 1.00
IGL02962:Rbsn APN 6 92190326 missense probably benign 0.00
R0172:Rbsn UTSW 6 92211607 missense probably damaging 0.99
R0735:Rbsn UTSW 6 92189693 missense probably benign 0.01
R0909:Rbsn UTSW 6 92189810 nonsense probably null
R1146:Rbsn UTSW 6 92201730 critical splice donor site probably null
R1146:Rbsn UTSW 6 92201730 critical splice donor site probably null
R1728:Rbsn UTSW 6 92190019 missense possibly damaging 0.69
R1729:Rbsn UTSW 6 92190019 missense possibly damaging 0.69
R1784:Rbsn UTSW 6 92190019 missense possibly damaging 0.69
R2135:Rbsn UTSW 6 92189873 missense probably benign
R2183:Rbsn UTSW 6 92189637 missense probably benign 0.02
R2324:Rbsn UTSW 6 92193966 missense probably damaging 1.00
R2890:Rbsn UTSW 6 92207123 missense possibly damaging 0.52
R3729:Rbsn UTSW 6 92191335 missense possibly damaging 0.81
R4007:Rbsn UTSW 6 92189819 missense probably benign 0.00
R5027:Rbsn UTSW 6 92198250 missense probably damaging 1.00
R5364:Rbsn UTSW 6 92193977 missense probably damaging 0.96
R5787:Rbsn UTSW 6 92199816 missense possibly damaging 0.81
R7092:Rbsn UTSW 6 92189626 missense probably damaging 1.00
R7134:Rbsn UTSW 6 92201627 missense probably damaging 1.00
R7165:Rbsn UTSW 6 92191334 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGCCTTTCAGTCTTGAGGCAG -3'
(R):5'- TGGGTAAGAAGGTCTTTACTTACTGC -3'

Sequencing Primer
(F):5'- GGCAGACAGTTTTGAACTACC -3'
(R):5'- TAAAACCTTGGGCTAATTTGTGC -3'
Posted On2015-07-07