Incidental Mutation 'R4356:Xdh'
ID 327574
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Name xanthine dehydrogenase
Synonyms xanthine oxidase, XO, Xor, Xox1, Xox-1
MMRRC Submission 041669-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.324) question?
Stock # R4356 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 73883908-73950182 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 73915690 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 560 (V560A)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
AlphaFold Q00519
Predicted Effect probably benign
Transcript: ENSMUST00000024866
AA Change: V560A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: V560A

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Meta Mutation Damage Score 0.0701 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 T C 12: 81,558,820 T723A probably damaging Het
Alox5 C T 6: 116,420,258 V322I probably benign Het
Alpk1 C T 3: 127,729,373 V7M probably damaging Het
Ankhd1 A T 18: 36,643,043 K1482* probably null Het
C130079G13Rik T A 3: 59,936,280 Y132N probably damaging Het
Cacna1e A C 1: 154,443,981 D1324E probably damaging Het
Ccdc150 A G 1: 54,353,054 D657G probably damaging Het
Celsr1 A G 15: 85,978,827 S1335P probably damaging Het
Cspg5 A G 9: 110,256,177 D391G probably damaging Het
Defa30 A T 8: 21,134,805 D48V possibly damaging Het
E2f7 T C 10: 110,759,851 Y136H probably damaging Het
Fbxw25 A T 9: 109,662,085 C122S probably damaging Het
Fgg A T 3: 83,012,943 D343V probably damaging Het
Flnb T A 14: 7,922,700 M1712K probably benign Het
Fnbp4 T C 2: 90,758,339 S485P probably damaging Het
Ftsj3 G A 11: 106,253,676 A134V probably benign Het
Gast C A 11: 100,336,547 S22Y probably damaging Het
Gm20834 T A Y: 10,322,962 H158L possibly damaging Het
Gm4788 T A 1: 139,732,310 K621N probably damaging Het
Ids C A X: 70,346,344 G506C probably damaging Het
Ifna15 G T 4: 88,557,842 T135N probably benign Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Impg2 C T 16: 56,260,164 T777I probably damaging Het
Kif11 C A 19: 37,411,435 T790K probably benign Het
Kif24 A G 4: 41,413,827 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrp10 C T 14: 54,468,366 R338C probably damaging Het
Mib1 A G 18: 10,751,844 N242S probably benign Het
Nectin1 A G 9: 43,792,505 D264G probably benign Het
Nipsnap3a T C 4: 52,995,979 probably null Het
Oit1 A G 14: 8,349,314 L212P probably damaging Het
Olfr1137 G A 2: 87,711,885 S7F possibly damaging Het
Olfr119 G T 17: 37,700,899 E76D probably damaging Het
P3h4 A G 11: 100,413,626 F263S probably damaging Het
Pcdhga4 C T 18: 37,687,611 H738Y probably damaging Het
Prickle2 A T 6: 92,411,509 I304K probably damaging Het
Ptprq A T 10: 107,608,364 Y1460N probably damaging Het
Rbl2 A G 8: 91,107,107 D812G probably damaging Het
Rbm19 A G 5: 120,140,362 T737A possibly damaging Het
Rbsn G A 6: 92,207,048 L95F possibly damaging Het
Sall4 T C 2: 168,755,480 E480G probably benign Het
Scfd1 T A 12: 51,439,285 N541K probably benign Het
Scube3 G A 17: 28,164,309 G442S probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Smarcc1 A G 9: 110,196,256 D667G probably damaging Het
Sned1 A T 1: 93,265,391 probably null Het
Spsb1 T C 4: 149,906,775 H112R probably damaging Het
Sun3 A G 11: 9,016,328 V231A probably damaging Het
Vmn2r106 A T 17: 20,279,648 D108E probably benign Het
Zfp352 T A 4: 90,223,834 H70Q possibly damaging Het
Zfp40 C A 17: 23,177,190 C73F probably benign Het
Zfp975 A C 7: 42,661,827 L454R probably damaging Het
Zik1 A T 7: 10,490,341 C276* probably null Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 73923106 missense possibly damaging 0.58
IGL00556:Xdh APN 17 73884435 makesense probably null
IGL01524:Xdh APN 17 73923137 critical splice acceptor site probably null
IGL01604:Xdh APN 17 73909337 missense probably benign 0.02
IGL01625:Xdh APN 17 73916786 critical splice donor site probably null
IGL01778:Xdh APN 17 73900280 missense probably benign 0.00
IGL01804:Xdh APN 17 73892759 missense probably damaging 1.00
IGL01825:Xdh APN 17 73891245 missense probably damaging 1.00
IGL01929:Xdh APN 17 73934855 missense probably damaging 1.00
IGL02068:Xdh APN 17 73913950 missense probably damaging 1.00
IGL02079:Xdh APN 17 73891277 missense probably damaging 1.00
IGL02210:Xdh APN 17 73943895 missense probably benign 0.00
IGL02261:Xdh APN 17 73913965 missense possibly damaging 0.81
IGL02365:Xdh APN 17 73943890 missense probably benign 0.14
IGL02424:Xdh APN 17 73926570 missense probably benign 0.00
IGL02491:Xdh APN 17 73886464 missense probably damaging 0.99
IGL02525:Xdh APN 17 73924995 missense possibly damaging 0.91
IGL02578:Xdh APN 17 73906246 missense probably damaging 1.00
IGL02793:Xdh APN 17 73900581 missense probably damaging 1.00
IGL02939:Xdh APN 17 73943845 critical splice donor site probably null
IGL03327:Xdh APN 17 73916792 missense probably benign
IGL03345:Xdh APN 17 73906032 missense probably damaging 0.98
IGL03353:Xdh APN 17 73895786 missense possibly damaging 0.65
inky UTSW 17 73921351 missense probably damaging 1.00
nucleus UTSW 17 73899012 nonsense probably null
squidgame UTSW 17 73939836 missense probably benign
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0033:Xdh UTSW 17 73907632 missense probably benign 0.06
R0079:Xdh UTSW 17 73891218 missense probably damaging 1.00
R0086:Xdh UTSW 17 73884438 missense probably benign
R0319:Xdh UTSW 17 73906101 splice site probably benign
R0336:Xdh UTSW 17 73922463 missense possibly damaging 0.91
R0389:Xdh UTSW 17 73898362 missense probably damaging 1.00
R0684:Xdh UTSW 17 73943891 missense probably damaging 0.97
R0930:Xdh UTSW 17 73923082 missense probably benign 0.00
R1073:Xdh UTSW 17 73939836 missense probably benign
R1114:Xdh UTSW 17 73941149 splice site probably benign
R1201:Xdh UTSW 17 73918418 missense probably benign 0.05
R1230:Xdh UTSW 17 73891256 missense probably damaging 1.00
R1351:Xdh UTSW 17 73923078 missense probably benign 0.02
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1485:Xdh UTSW 17 73914019 nonsense probably null
R1548:Xdh UTSW 17 73913901 missense probably damaging 0.98
R1637:Xdh UTSW 17 73900578 missense probably benign
R1641:Xdh UTSW 17 73926552 missense probably benign
R1758:Xdh UTSW 17 73910209 missense probably damaging 1.00
R1951:Xdh UTSW 17 73907658 missense probably damaging 1.00
R1969:Xdh UTSW 17 73892751 missense possibly damaging 0.55
R2024:Xdh UTSW 17 73921305 missense possibly damaging 0.92
R2080:Xdh UTSW 17 73909325 missense probably damaging 1.00
R2157:Xdh UTSW 17 73922537 missense probably damaging 1.00
R2300:Xdh UTSW 17 73891265 missense probably damaging 1.00
R3783:Xdh UTSW 17 73893595 splice site probably benign
R3796:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3797:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3798:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3799:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3819:Xdh UTSW 17 73906725 missense probably benign 0.35
R4085:Xdh UTSW 17 73916879 missense probably benign 0.35
R4240:Xdh UTSW 17 73895795 missense possibly damaging 0.72
R4522:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4523:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4524:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4600:Xdh UTSW 17 73910200 missense probably benign 0.19
R4617:Xdh UTSW 17 73918394 missense probably damaging 0.99
R4756:Xdh UTSW 17 73886386 missense probably benign 0.24
R4761:Xdh UTSW 17 73910267 missense possibly damaging 0.91
R4815:Xdh UTSW 17 73906215 missense probably damaging 1.00
R4850:Xdh UTSW 17 73898335 missense probably damaging 1.00
R4896:Xdh UTSW 17 73910243 missense probably damaging 0.96
R4897:Xdh UTSW 17 73900708 missense probably benign
R4923:Xdh UTSW 17 73924936 missense possibly damaging 0.72
R4977:Xdh UTSW 17 73898970 missense probably benign 0.05
R5030:Xdh UTSW 17 73891293 missense probably damaging 1.00
R5185:Xdh UTSW 17 73925011 missense probably damaging 1.00
R5347:Xdh UTSW 17 73925032 missense probably benign
R5556:Xdh UTSW 17 73897764 missense probably benign 0.21
R5566:Xdh UTSW 17 73893622 missense probably damaging 1.00
R5568:Xdh UTSW 17 73943885 missense possibly damaging 0.90
R5635:Xdh UTSW 17 73913875 missense possibly damaging 0.92
R5662:Xdh UTSW 17 73941115 missense probably damaging 0.99
R5955:Xdh UTSW 17 73898320 missense probably damaging 1.00
R6058:Xdh UTSW 17 73906269 missense probably damaging 1.00
R6061:Xdh UTSW 17 73921347 missense probably damaging 1.00
R6412:Xdh UTSW 17 73935907 missense probably benign 0.09
R6526:Xdh UTSW 17 73900551 missense probably damaging 0.97
R6558:Xdh UTSW 17 73893713 missense possibly damaging 0.95
R6843:Xdh UTSW 17 73923130 missense probably damaging 1.00
R6932:Xdh UTSW 17 73922562 missense probably damaging 0.99
R7028:Xdh UTSW 17 73943873 missense probably damaging 0.99
R7418:Xdh UTSW 17 73913965 missense possibly damaging 0.81
R7503:Xdh UTSW 17 73926210 missense probably damaging 1.00
R7653:Xdh UTSW 17 73897045 missense probably benign 0.10
R7763:Xdh UTSW 17 73934834 missense possibly damaging 0.69
R7768:Xdh UTSW 17 73939836 missense probably benign
R7904:Xdh UTSW 17 73922472 missense probably benign 0.09
R8010:Xdh UTSW 17 73909317 nonsense probably null
R8067:Xdh UTSW 17 73900657 missense probably benign 0.01
R8238:Xdh UTSW 17 73886417 missense probably benign
R8253:Xdh UTSW 17 73918382 missense possibly damaging 0.94
R8346:Xdh UTSW 17 73913943 missense probably damaging 1.00
R8350:Xdh UTSW 17 73934842 missense probably damaging 1.00
R8381:Xdh UTSW 17 73912461 missense probably benign
R8427:Xdh UTSW 17 73935931 missense probably damaging 1.00
R8465:Xdh UTSW 17 73899012 nonsense probably null
R8478:Xdh UTSW 17 73906058 missense probably benign 0.00
R8680:Xdh UTSW 17 73922505 missense probably benign
R8802:Xdh UTSW 17 73918410 missense probably benign 0.00
R8984:Xdh UTSW 17 73921351 missense probably damaging 1.00
R8985:Xdh UTSW 17 73921351 missense probably damaging 1.00
R8995:Xdh UTSW 17 73898374 missense probably damaging 1.00
R9035:Xdh UTSW 17 73910227 missense probably benign
R9149:Xdh UTSW 17 73915693 missense probably benign
R9181:Xdh UTSW 17 73925011 missense probably damaging 1.00
R9357:Xdh UTSW 17 73907716 missense probably damaging 0.97
R9357:Xdh UTSW 17 73926546 critical splice donor site probably null
R9609:Xdh UTSW 17 73924995 missense possibly damaging 0.91
R9803:Xdh UTSW 17 73922460 missense probably benign
X0019:Xdh UTSW 17 73918454 missense probably damaging 1.00
Z1088:Xdh UTSW 17 73886428 missense probably benign
Z1176:Xdh UTSW 17 73923042 critical splice donor site probably null
Z1177:Xdh UTSW 17 73897695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGATAGCTGCAGTGGC -3'
(R):5'- AGATCCAGCACTGTATTCAAAACTC -3'

Sequencing Primer
(F):5'- AGTGGCAGCAGTGTGGCTC -3'
(R):5'- CTGAGGGGATGGGGGATG -3'
Posted On 2015-07-07