Incidental Mutation 'R4405:Lancl1'
ID327582
Institutional Source Beutler Lab
Gene Symbol Lancl1
Ensembl Gene ENSMUSG00000026000
Gene NameLanC (bacterial lantibiotic synthetase component C)-like 1
Synonymsp40, LanC-like protein 1, Gpr69a
MMRRC Submission 041134-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R4405 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location67000517-67038872 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 67020856 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027149] [ENSMUST00000113979] [ENSMUST00000119559] [ENSMUST00000149996] [ENSMUST00000149996]
Predicted Effect probably null
Transcript: ENSMUST00000027149
SMART Domains Protein: ENSMUSP00000027149
Gene: ENSMUSG00000026000

DomainStartEndE-ValueType
LANC_like 55 399 7.17e-144 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113979
SMART Domains Protein: ENSMUSP00000109612
Gene: ENSMUSG00000026000

DomainStartEndE-ValueType
LANC_like 55 399 7.17e-144 SMART
Predicted Effect probably null
Transcript: ENSMUST00000119559
SMART Domains Protein: ENSMUSP00000113080
Gene: ENSMUSG00000026000

DomainStartEndE-ValueType
LANC_like 55 399 7.17e-144 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133508
Predicted Effect probably null
Transcript: ENSMUST00000149996
SMART Domains Protein: ENSMUSP00000122752
Gene: ENSMUSG00000026000

DomainStartEndE-ValueType
Pfam:LANC_like 55 173 2.3e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000149996
SMART Domains Protein: ENSMUSP00000122752
Gene: ENSMUSG00000026000

DomainStartEndE-ValueType
Pfam:LANC_like 55 173 2.3e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189210
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a loosely associated peripheral membrane protein related to the LanC family of bacterial membrane-associated proteins involved in the biosynthesis of antimicrobial peptides. This protein may play a role as a peptide-modifying enzyme component in eukaryotic cells. Previously considered a member of the G-protein-coupled receptor superfamily, this protein is now in the LanC family. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a null mutation display postnatal neurodegeneration with increased oxidative stress and mitochondrial impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg3 C T 8: 95,036,908 A279V probably benign Het
Aggf1 G A 13: 95,371,594 P88L probably benign Het
Asb18 T C 1: 89,968,689 T210A probably benign Het
Cd8b1 C T 6: 71,326,022 S27L possibly damaging Het
Cfap43 C T 19: 47,739,797 S1507N possibly damaging Het
Col12a1 A T 9: 79,639,965 probably null Het
Col19a1 G A 1: 24,534,109 T194M unknown Het
Cpb1 T A 3: 20,263,569 T237S probably benign Het
Cubn G A 2: 13,466,030 T517M probably damaging Het
Dnah6 T C 6: 73,129,291 N1769S probably benign Het
Dnm1 A G 2: 32,335,972 I365T probably damaging Het
E2f5 T A 3: 14,603,763 D238E probably benign Het
Etv6 A G 6: 134,233,534 E115G probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gapvd1 C T 2: 34,728,735 V209I probably damaging Het
Gbp8 G A 5: 105,051,062 probably benign Het
Gprc6a T C 10: 51,628,543 I68M probably benign Het
Grb14 T C 2: 64,953,622 N54D probably damaging Het
Gucy2g A T 19: 55,237,837 F216I probably benign Het
Herc2 T A 7: 56,170,477 L2849Q probably damaging Het
Hsd17b4 G T 18: 50,128,314 probably benign Het
Igkv9-129 T A 6: 67,839,800 M3K probably damaging Het
Iqcd A T 5: 120,602,420 E272V probably damaging Het
Itih2 A T 2: 10,106,737 Y463* probably null Het
Kcna10 G A 3: 107,195,465 E471K possibly damaging Het
Klf3 A T 5: 64,829,004 E294V possibly damaging Het
Lrig3 T C 10: 126,011,008 F882L probably benign Het
Man2c1 A G 9: 57,139,083 N474S probably damaging Het
Map4k3 A G 17: 80,615,015 probably null Het
Mast1 C A 8: 84,920,891 W572C probably damaging Het
Mbd4 T A 6: 115,849,115 Q305L possibly damaging Het
Mbl2 T A 19: 30,239,516 S243T probably benign Het
Mcph1 C T 8: 18,632,541 P565S probably benign Het
Mfsd1 G C 3: 67,600,610 V435L probably benign Het
Mycbp2 C T 14: 103,123,445 G1183D probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Noa1 A T 5: 77,306,372 S474T probably benign Het
Nrde2 A G 12: 100,130,584 Y986H probably benign Het
Oca2 G T 7: 56,414,434 V726F possibly damaging Het
Olfr57 A T 10: 79,035,410 M205L probably benign Het
Olfr695 T A 7: 106,873,373 S291C probably damaging Het
Pip5k1a A G 3: 95,068,059 probably null Het
Plekhn1 A T 4: 156,225,273 probably null Het
Sec61a2 T C 2: 5,882,859 D104G probably benign Het
Slc25a36 T C 9: 97,085,118 T131A probably benign Het
Slc5a11 A T 7: 123,258,477 D263V probably damaging Het
Sorbs1 T C 19: 40,395,745 I35V probably benign Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Tbc1d1 T C 5: 64,173,670 V64A possibly damaging Het
Tmem159 T G 7: 120,115,491 F68V probably damaging Het
Ttc37 A T 13: 76,155,665 Y1234F probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn1r20 A G 6: 57,432,057 M123V probably benign Het
Zwint T C 10: 72,656,263 L59P probably damaging Het
Other mutations in Lancl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00852:Lancl1 APN 1 67004837 missense probably damaging 1.00
IGL01727:Lancl1 APN 1 67020942 missense probably damaging 1.00
IGL01800:Lancl1 APN 1 67020870 missense probably benign 0.08
IGL03036:Lancl1 APN 1 67006915 missense probably damaging 1.00
IGL03329:Lancl1 APN 1 67021050 missense probably damaging 1.00
R0535:Lancl1 UTSW 1 67009906 unclassified probably benign
R0731:Lancl1 UTSW 1 67009910 critical splice donor site probably null
R3798:Lancl1 UTSW 1 67034144 missense probably damaging 1.00
R4933:Lancl1 UTSW 1 67021034 missense probably benign 0.08
R4980:Lancl1 UTSW 1 67004809 missense probably benign 0.17
R5193:Lancl1 UTSW 1 67021014 missense probably benign 0.02
R6643:Lancl1 UTSW 1 67004383 missense probably benign 0.07
R7235:Lancl1 UTSW 1 67038535 missense probably benign 0.00
R7250:Lancl1 UTSW 1 67009299 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- AAGATAAGGATTACAAGGCGATTCC -3'
(R):5'- GCTTACATTCCAGGCATCGC -3'

Sequencing Primer
(F):5'- GGCGATTCCTTAACTATAAGAGGAAC -3'
(R):5'- ACCTCCACAATGTGTTTGGG -3'
Posted On2015-07-07