Mutagenetix > Incidental Mutation

Incidental Mutation 'R0045:Ap3b2'

32761

Institutional Source

Beutler Lab

Gene Symbol

Ap3b2

Ensembl Gene

ENSMUSG00000062444

Gene Name

adaptor-related protein complex 3, beta 2 subunit

Synonyms

beta3B, Naptb

MMRRC Submission

038339-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R0045 (G1)

Quality Score

145

Status

Validated

Chromosome

Chromosomal Location

81460399-81493925 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 81466193 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 650 (D650G)

Ref Sequence

ENSEMBL: ENSMUSP00000080739 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082090]

AlphaFold

Q9JME5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000082090
AA Change: D650G

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: D650G

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	34	590	8.2e-182	PFAM
low complexity region	689	782	N/A	INTRINSIC
AP3B1_C	801	947	4.58e-75	SMART
Blast:B2	971	1080	2e-12	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147624

Meta Mutation Damage Score

0.1242

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 94.1%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb9	T	C	5: 124,082,085	N299S	probably damaging	Het
Abi3	A	G	11: 95,832,715	*368R	probably null	Het
Agbl1	T	C	7: 76,698,840		probably null	Het
Arhgap30	A	G	1: 171,408,430	S791G	probably benign	Het
Arvcf	T	A	16: 18,403,458	L722Q	probably benign	Het
Ascc3	C	T	10: 50,718,402	R1198*	probably null	Het
Atf2	G	T	2: 73,829,856	T189N	probably benign	Het
Atf7ip	A	G	6: 136,559,816	K16E	probably damaging	Het
Atg9b	G	T	5: 24,387,398	Q621K	probably damaging	Het
Atp12a	G	A	14: 56,372,873	E234K	probably damaging	Het
C8a	T	C	4: 104,826,815	K368E	probably benign	Het
Cdh23	T	C	10: 60,530,978	Y241C	probably damaging	Het
Cdon	G	A	9: 35,486,807	S940N	probably benign	Het
Cds2	G	T	2: 132,305,155	G402V	possibly damaging	Het
Cog6	T	C	3: 52,992,750		probably null	Het
Commd10	T	C	18: 46,967,836	S114P	possibly damaging	Het
Dram2	T	C	3: 106,570,817	V155A	possibly damaging	Het
Egr2	T	A	10: 67,540,480	V252E	probably benign	Het
Exoc3l	C	T	8: 105,293,685	V203M	probably damaging	Het
Fsip1	C	A	2: 118,248,292		probably null	Het
Gm10840	C	A	11: 106,161,100		probably benign	Het
Gm8251	T	C	1: 44,057,205	K1578E	probably benign	Het
Gpr37l1	A	G	1: 135,161,145	L394P	probably damaging	Het
Gsap	T	C	5: 21,226,832	M243T	possibly damaging	Het
Hsd3b5	T	A	3: 98,619,144	I329F	probably benign	Het
Htra1	T	A	7: 130,961,532	S164R	probably damaging	Het
Il17b	G	A	18: 61,690,244	V50M	probably damaging	Het
Itga4	A	T	2: 79,301,031	Y581F	probably damaging	Het
Jmjd8	A	G	17: 25,829,281	E92G	probably damaging	Het
Kcnq4	T	A	4: 120,697,955	D677V	probably damaging	Het
Klhl42	A	G	6: 147,092,168	T213A	probably benign	Het
Lcn5	T	C	2: 25,660,698	S133P	probably damaging	Het
Liph	T	C	16: 21,968,053	Y271C	probably damaging	Het
Lpcat3	T	C	6: 124,701,474	I228T	probably benign	Het
Lrrd1	A	G	5: 3,866,418	K812E	possibly damaging	Het
Ltbp2	G	A	12: 84,809,587	T701I	probably damaging	Het
Ltbp2	T	C	12: 84,813,288	T631A	probably damaging	Het
Mavs	G	A	2: 131,238,831	R13Q	probably damaging	Het
Mtor	C	G	4: 148,464,949	H597D	probably benign	Het
Muc5b	T	A	7: 141,856,818	H1309Q	unknown	Het
Myl3	A	C	9: 110,767,929	D119A	probably damaging	Het
Nnat	A	T	2: 157,560,488		probably benign	Het
Olfr183	G	A	16: 59,000,491	D269N	probably benign	Het
Olfr293	T	C	7: 86,664,340	L226S	possibly damaging	Het
Olfr703	T	A	7: 106,845,389	Y259*	probably null	Het
Olfr869	A	T	9: 20,137,191	Q25L	probably benign	Het
Pclo	C	T	5: 14,539,471	A595V	unknown	Het
Pcsk6	T	A	7: 65,962,928	C315S	probably damaging	Het
Pkd2	T	A	5: 104,455,805		probably benign	Het
Ppp2r3c	T	A	12: 55,293,821	I155F	probably damaging	Het
Rapgef4	A	G	2: 72,198,778	H398R	possibly damaging	Het
Ripor2	A	G	13: 24,694,226	D328G	probably damaging	Het
Rpgrip1	A	T	14: 52,141,144	T509S	possibly damaging	Het
Sh3pxd2a	A	G	19: 47,267,183	I1032T	probably damaging	Het
Slc25a13	A	T	6: 6,109,277	S362T	probably benign	Het
Stk35	A	T	2: 129,800,568	R10*	probably null	Het
Tal1	A	G	4: 115,068,565	D277G	probably damaging	Het
Tecta	G	A	9: 42,375,191	T723I	probably damaging	Het
Trp53bp1	A	C	2: 121,204,497	V103G	probably benign	Het
Trpv4	A	G	5: 114,636,457	S189P	probably benign	Het
Ttll5	T	G	12: 85,879,359		probably benign	Het
Usp8	A	G	2: 126,742,223	T451A	probably benign	Het
Vac14	G	A	8: 110,636,952	D340N	probably benign	Het
Vars	C	A	17: 34,998,066	A471S	probably benign	Het
Vars	A	T	17: 35,010,619	H404L	probably damaging	Het
Vmn2r70	T	C	7: 85,566,044	N94S	probably damaging	Het
Vpreb2	T	C	16: 17,980,767	L39P	probably damaging	Het
Vps13a	A	T	19: 16,640,810	L693*	probably null	Het
Wapl	A	G	14: 34,733,794	I176V	probably benign	Het
Wdr31	G	T	4: 62,464,033	L4I	possibly damaging	Het

Other mutations in Ap3b2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00772:Ap3b2	APN	7	81471949	missense	probably damaging	0.98
IGL01695:Ap3b2	APN	7	81476939	splice site	probably benign
IGL01876:Ap3b2	APN	7	81473854	splice site	probably null
IGL02132:Ap3b2	APN	7	81460998	missense	unknown
IGL02227:Ap3b2	APN	7	81473404	missense	probably damaging	1.00
IGL02660:Ap3b2	APN	7	81465698	missense	probably benign	0.13
R0045:Ap3b2	UTSW	7	81466193	missense	possibly damaging	0.82
R0142:Ap3b2	UTSW	7	81473080	missense	probably damaging	0.96
R0317:Ap3b2	UTSW	7	81463681	splice site	probably null
R0568:Ap3b2	UTSW	7	81464629	critical splice donor site	probably null
R1035:Ap3b2	UTSW	7	81463911	missense	unknown
R1121:Ap3b2	UTSW	7	81464195	missense	unknown
R1160:Ap3b2	UTSW	7	81466169	critical splice donor site	probably null
R1489:Ap3b2	UTSW	7	81463690	nonsense	probably null
R1542:Ap3b2	UTSW	7	81478077	splice site	probably null
R1652:Ap3b2	UTSW	7	81473399	missense	probably damaging	1.00
R1741:Ap3b2	UTSW	7	81467599	missense	possibly damaging	0.95
R1872:Ap3b2	UTSW	7	81464150	missense	unknown
R2065:Ap3b2	UTSW	7	81463774	missense	unknown
R2353:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R2354:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R2398:Ap3b2	UTSW	7	81477195	missense	probably damaging	0.99
R3421:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3710:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3932:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3933:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R4152:Ap3b2	UTSW	7	81478017	missense	probably damaging	1.00
R4209:Ap3b2	UTSW	7	81477136	missense	probably benign	0.02
R4732:Ap3b2	UTSW	7	81471932	missense	probably damaging	1.00
R4733:Ap3b2	UTSW	7	81471932	missense	probably damaging	1.00
R4841:Ap3b2	UTSW	7	81477930	missense	probably damaging	1.00
R5207:Ap3b2	UTSW	7	81476769	missense	possibly damaging	0.48
R5659:Ap3b2	UTSW	7	81476752	missense	probably damaging	0.98
R6109:Ap3b2	UTSW	7	81493592	missense	possibly damaging	0.55
R6223:Ap3b2	UTSW	7	81473462	nonsense	probably null
R6901:Ap3b2	UTSW	7	81484912	critical splice acceptor site	probably null
R6981:Ap3b2	UTSW	7	81477993	missense	probably damaging	1.00
R7061:Ap3b2	UTSW	7	81461009	missense	unknown
R7317:Ap3b2	UTSW	7	81461028	missense	unknown
R7501:Ap3b2	UTSW	7	81473446	missense	probably damaging	0.99
R7543:Ap3b2	UTSW	7	81466146	splice site	probably null
R7643:Ap3b2	UTSW	7	81477072	missense	probably benign	0.24
R7707:Ap3b2	UTSW	7	81476782	missense	possibly damaging	0.60
R8111:Ap3b2	UTSW	7	81463782	missense	unknown
R8273:Ap3b2	UTSW	7	81463242	missense	unknown
R8325:Ap3b2	UTSW	7	81484489	splice site	probably null
R8355:Ap3b2	UTSW	7	81473103	missense	probably damaging	1.00
R8697:Ap3b2	UTSW	7	81473035	missense	possibly damaging	0.91
R8716:Ap3b2	UTSW	7	81477153	missense	probably benign	0.03
R8923:Ap3b2	UTSW	7	81477183	missense	probably benign	0.08
R9002:Ap3b2	UTSW	7	81467444	missense	probably benign	0.02
R9163:Ap3b2	UTSW	7	81463798	missense	unknown
R9304:Ap3b2	UTSW	7	81463271	missense	unknown
R9321:Ap3b2	UTSW	7	81464504	critical splice acceptor site	probably null
R9413:Ap3b2	UTSW	7	81478009	missense	possibly damaging	0.45
R9459:Ap3b2	UTSW	7	81473903	missense	probably benign	0.16
R9746:Ap3b2	UTSW	7	81476344	missense	probably damaging	1.00
X0013:Ap3b2	UTSW	7	81463240	critical splice donor site	probably null
X0028:Ap3b2	UTSW	7	81463764	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AAAGGATCTGGGCACAGCACAC -3'
(R):5'- TCTCCTCATAGAGACCTGAGCAGC -3'

Sequencing Primer
(F):5'- TACACAGCACACAGAGGGG -3'
(R):5'- AATGACAACTTTGGCCCTGG -3'

Posted On

2013-05-09