Incidental Mutation 'R0045:Ap3b2'
ID 32761
Institutional Source Beutler Lab
Gene Symbol Ap3b2
Ensembl Gene ENSMUSG00000062444
Gene Name adaptor-related protein complex 3, beta 2 subunit
Synonyms Naptb, beta3B
MMRRC Submission 038339-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R0045 (G1)
Quality Score 145
Status Validated
Chromosome 7
Chromosomal Location 81110147-81143673 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 81115941 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 650 (D650G)
Ref Sequence ENSEMBL: ENSMUSP00000080739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082090]
AlphaFold Q9JME5
Predicted Effect possibly damaging
Transcript: ENSMUST00000082090
AA Change: D650G

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: D650G

DomainStartEndE-ValueType
Pfam:Adaptin_N 34 590 8.2e-182 PFAM
low complexity region 689 782 N/A INTRINSIC
AP3B1_C 801 947 4.58e-75 SMART
Blast:B2 971 1080 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147624
Meta Mutation Damage Score 0.1242 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,220,148 (GRCm39) N299S probably damaging Het
Abi3 A G 11: 95,723,541 (GRCm39) *368R probably null Het
Agbl1 T C 7: 76,348,588 (GRCm39) probably null Het
Arhgap30 A G 1: 171,235,998 (GRCm39) S791G probably benign Het
Arvcf T A 16: 18,222,208 (GRCm39) L722Q probably benign Het
Ascc3 C T 10: 50,594,498 (GRCm39) R1198* probably null Het
Atf2 G T 2: 73,660,200 (GRCm39) T189N probably benign Het
Atf7ip A G 6: 136,536,814 (GRCm39) K16E probably damaging Het
Atg9b G T 5: 24,592,396 (GRCm39) Q621K probably damaging Het
Atp12a G A 14: 56,610,330 (GRCm39) E234K probably damaging Het
C8a T C 4: 104,684,012 (GRCm39) K368E probably benign Het
Ccdc168 T C 1: 44,096,365 (GRCm39) K1578E probably benign Het
Cdh23 T C 10: 60,366,757 (GRCm39) Y241C probably damaging Het
Cdon G A 9: 35,398,103 (GRCm39) S940N probably benign Het
Cds2 G T 2: 132,147,075 (GRCm39) G402V possibly damaging Het
Cog6 T C 3: 52,900,171 (GRCm39) probably null Het
Commd10 T C 18: 47,100,903 (GRCm39) S114P possibly damaging Het
Dram2 T C 3: 106,478,133 (GRCm39) V155A possibly damaging Het
Egr2 T A 10: 67,376,310 (GRCm39) V252E probably benign Het
Exoc3l C T 8: 106,020,317 (GRCm39) V203M probably damaging Het
Fsip1 C A 2: 118,078,773 (GRCm39) probably null Het
Gm10840 C A 11: 106,051,926 (GRCm39) probably benign Het
Gpr37l1 A G 1: 135,088,883 (GRCm39) L394P probably damaging Het
Gsap T C 5: 21,431,830 (GRCm39) M243T possibly damaging Het
Hsd3b5 T A 3: 98,526,460 (GRCm39) I329F probably benign Het
Htra1 T A 7: 130,563,262 (GRCm39) S164R probably damaging Het
Il17b G A 18: 61,823,315 (GRCm39) V50M probably damaging Het
Itga4 A T 2: 79,131,375 (GRCm39) Y581F probably damaging Het
Jmjd8 A G 17: 26,048,255 (GRCm39) E92G probably damaging Het
Kcnq4 T A 4: 120,555,152 (GRCm39) D677V probably damaging Het
Klhl42 A G 6: 146,993,666 (GRCm39) T213A probably benign Het
Lcn5 T C 2: 25,550,710 (GRCm39) S133P probably damaging Het
Liph T C 16: 21,786,803 (GRCm39) Y271C probably damaging Het
Lpcat3 T C 6: 124,678,437 (GRCm39) I228T probably benign Het
Lrrd1 A G 5: 3,916,418 (GRCm39) K812E possibly damaging Het
Ltbp2 T C 12: 84,860,062 (GRCm39) T631A probably damaging Het
Ltbp2 G A 12: 84,856,361 (GRCm39) T701I probably damaging Het
Mavs G A 2: 131,080,751 (GRCm39) R13Q probably damaging Het
Mtor C G 4: 148,549,406 (GRCm39) H597D probably benign Het
Muc5b T A 7: 141,410,555 (GRCm39) H1309Q unknown Het
Myl3 A C 9: 110,596,997 (GRCm39) D119A probably damaging Het
Nnat A T 2: 157,402,408 (GRCm39) probably benign Het
Or14c40 T C 7: 86,313,548 (GRCm39) L226S possibly damaging Het
Or2ag19 T A 7: 106,444,596 (GRCm39) Y259* probably null Het
Or5h17 G A 16: 58,820,854 (GRCm39) D269N probably benign Het
Or7e175 A T 9: 20,048,487 (GRCm39) Q25L probably benign Het
Pclo C T 5: 14,589,485 (GRCm39) A595V unknown Het
Pcsk6 T A 7: 65,612,676 (GRCm39) C315S probably damaging Het
Pkd2 T A 5: 104,603,671 (GRCm39) probably benign Het
Ppp2r3c T A 12: 55,340,606 (GRCm39) I155F probably damaging Het
Rapgef4 A G 2: 72,029,122 (GRCm39) H398R possibly damaging Het
Ripor2 A G 13: 24,878,209 (GRCm39) D328G probably damaging Het
Rpgrip1 A T 14: 52,378,601 (GRCm39) T509S possibly damaging Het
Sh3pxd2a A G 19: 47,255,622 (GRCm39) I1032T probably damaging Het
Slc25a13 A T 6: 6,109,277 (GRCm39) S362T probably benign Het
Stk35 A T 2: 129,642,488 (GRCm39) R10* probably null Het
Tal1 A G 4: 114,925,762 (GRCm39) D277G probably damaging Het
Tecta G A 9: 42,286,487 (GRCm39) T723I probably damaging Het
Trp53bp1 A C 2: 121,034,978 (GRCm39) V103G probably benign Het
Trpv4 A G 5: 114,774,518 (GRCm39) S189P probably benign Het
Ttll5 T G 12: 85,926,133 (GRCm39) probably benign Het
Usp8 A G 2: 126,584,143 (GRCm39) T451A probably benign Het
Vac14 G A 8: 111,363,584 (GRCm39) D340N probably benign Het
Vars1 C A 17: 35,217,042 (GRCm39) A471S probably benign Het
Vars1 A T 17: 35,229,595 (GRCm39) H404L probably damaging Het
Vmn2r70 T C 7: 85,215,252 (GRCm39) N94S probably damaging Het
Vpreb1b T C 16: 17,798,631 (GRCm39) L39P probably damaging Het
Vps13a A T 19: 16,618,174 (GRCm39) L693* probably null Het
Wapl A G 14: 34,455,751 (GRCm39) I176V probably benign Het
Wdr31 G T 4: 62,382,270 (GRCm39) L4I possibly damaging Het
Other mutations in Ap3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Ap3b2 APN 7 81,121,697 (GRCm39) missense probably damaging 0.98
IGL01695:Ap3b2 APN 7 81,126,687 (GRCm39) splice site probably benign
IGL01876:Ap3b2 APN 7 81,123,602 (GRCm39) splice site probably null
IGL02132:Ap3b2 APN 7 81,110,746 (GRCm39) missense unknown
IGL02227:Ap3b2 APN 7 81,123,152 (GRCm39) missense probably damaging 1.00
IGL02660:Ap3b2 APN 7 81,115,446 (GRCm39) missense probably benign 0.13
R0045:Ap3b2 UTSW 7 81,115,941 (GRCm39) missense possibly damaging 0.82
R0142:Ap3b2 UTSW 7 81,122,828 (GRCm39) missense probably damaging 0.96
R0317:Ap3b2 UTSW 7 81,113,429 (GRCm39) splice site probably null
R0568:Ap3b2 UTSW 7 81,114,377 (GRCm39) critical splice donor site probably null
R1035:Ap3b2 UTSW 7 81,113,659 (GRCm39) missense unknown
R1121:Ap3b2 UTSW 7 81,113,943 (GRCm39) missense unknown
R1160:Ap3b2 UTSW 7 81,115,917 (GRCm39) critical splice donor site probably null
R1489:Ap3b2 UTSW 7 81,113,438 (GRCm39) nonsense probably null
R1542:Ap3b2 UTSW 7 81,127,825 (GRCm39) splice site probably null
R1652:Ap3b2 UTSW 7 81,123,147 (GRCm39) missense probably damaging 1.00
R1741:Ap3b2 UTSW 7 81,117,347 (GRCm39) missense possibly damaging 0.95
R1872:Ap3b2 UTSW 7 81,113,898 (GRCm39) missense unknown
R2065:Ap3b2 UTSW 7 81,113,522 (GRCm39) missense unknown
R2353:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R2354:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R2398:Ap3b2 UTSW 7 81,126,943 (GRCm39) missense probably damaging 0.99
R3421:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3710:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3932:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3933:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R4152:Ap3b2 UTSW 7 81,127,765 (GRCm39) missense probably damaging 1.00
R4209:Ap3b2 UTSW 7 81,126,884 (GRCm39) missense probably benign 0.02
R4732:Ap3b2 UTSW 7 81,121,680 (GRCm39) missense probably damaging 1.00
R4733:Ap3b2 UTSW 7 81,121,680 (GRCm39) missense probably damaging 1.00
R4841:Ap3b2 UTSW 7 81,127,678 (GRCm39) missense probably damaging 1.00
R5207:Ap3b2 UTSW 7 81,126,517 (GRCm39) missense possibly damaging 0.48
R5659:Ap3b2 UTSW 7 81,126,500 (GRCm39) missense probably damaging 0.98
R6109:Ap3b2 UTSW 7 81,143,340 (GRCm39) missense possibly damaging 0.55
R6223:Ap3b2 UTSW 7 81,123,210 (GRCm39) nonsense probably null
R6901:Ap3b2 UTSW 7 81,134,660 (GRCm39) critical splice acceptor site probably null
R6981:Ap3b2 UTSW 7 81,127,741 (GRCm39) missense probably damaging 1.00
R7061:Ap3b2 UTSW 7 81,110,757 (GRCm39) missense unknown
R7317:Ap3b2 UTSW 7 81,110,776 (GRCm39) missense unknown
R7501:Ap3b2 UTSW 7 81,123,194 (GRCm39) missense probably damaging 0.99
R7543:Ap3b2 UTSW 7 81,115,894 (GRCm39) splice site probably null
R7643:Ap3b2 UTSW 7 81,126,820 (GRCm39) missense probably benign 0.24
R7707:Ap3b2 UTSW 7 81,126,530 (GRCm39) missense possibly damaging 0.60
R8111:Ap3b2 UTSW 7 81,113,530 (GRCm39) missense unknown
R8273:Ap3b2 UTSW 7 81,112,990 (GRCm39) missense unknown
R8325:Ap3b2 UTSW 7 81,134,237 (GRCm39) splice site probably null
R8355:Ap3b2 UTSW 7 81,122,851 (GRCm39) missense probably damaging 1.00
R8697:Ap3b2 UTSW 7 81,122,783 (GRCm39) missense possibly damaging 0.91
R8716:Ap3b2 UTSW 7 81,126,901 (GRCm39) missense probably benign 0.03
R8923:Ap3b2 UTSW 7 81,126,931 (GRCm39) missense probably benign 0.08
R9002:Ap3b2 UTSW 7 81,117,192 (GRCm39) missense probably benign 0.02
R9163:Ap3b2 UTSW 7 81,113,546 (GRCm39) missense unknown
R9304:Ap3b2 UTSW 7 81,113,019 (GRCm39) missense unknown
R9321:Ap3b2 UTSW 7 81,114,252 (GRCm39) critical splice acceptor site probably null
R9413:Ap3b2 UTSW 7 81,127,757 (GRCm39) missense possibly damaging 0.45
R9459:Ap3b2 UTSW 7 81,123,651 (GRCm39) missense probably benign 0.16
R9746:Ap3b2 UTSW 7 81,126,092 (GRCm39) missense probably damaging 1.00
X0013:Ap3b2 UTSW 7 81,112,988 (GRCm39) critical splice donor site probably null
X0028:Ap3b2 UTSW 7 81,113,512 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAAGGATCTGGGCACAGCACAC -3'
(R):5'- TCTCCTCATAGAGACCTGAGCAGC -3'

Sequencing Primer
(F):5'- TACACAGCACACAGAGGGG -3'
(R):5'- AATGACAACTTTGGCCCTGG -3'
Posted On 2013-05-09