Incidental Mutation 'R4405:Etv6'
ID 327615
Institutional Source Beutler Lab
Gene Symbol Etv6
Ensembl Gene ENSMUSG00000030199
Gene Name ets variant 6
Synonyms translocation-ets-leukemia, Tel
MMRRC Submission 041134-MU
Accession Numbers

Ncbi RefSeq: NM_007961.3; MGI: 109336

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4405 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 134035700-134270158 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 134233534 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 115 (E115G)
Ref Sequence ENSEMBL: ENSMUSP00000130761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081028] [ENSMUST00000111963] [ENSMUST00000164648]
AlphaFold P97360
Predicted Effect probably damaging
Transcript: ENSMUST00000081028
AA Change: E116G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079818
Gene: ENSMUSG00000030199
AA Change: E116G

DomainStartEndE-ValueType
SAM_PNT 39 125 3.49e-41 SMART
ETS 334 420 7.02e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111963
AA Change: E27G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107594
Gene: ENSMUSG00000030199
AA Change: E27G

DomainStartEndE-ValueType
Pfam:SAM_PNT 1 36 1.3e-10 PFAM
ETS 245 331 7.02e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164648
AA Change: E115G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130761
Gene: ENSMUSG00000030199
AA Change: E115G

DomainStartEndE-ValueType
SAM_PNT 38 124 3.49e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171098
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype Strain: 2177950; 3056143
Lethality: E11-E14
FUNCTION: This gene encodes a transcriptional repressor belonging to the ETS family of proteins. Knockout of this gene in mice results in embryonic lethality due to defective angiogenesis. In humans, this gene is often involved in chromosome rearrangements associated with specific cancers. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defective yolk sac angiogenesis, excess apoptosis of mesenchymal and neural cells, and midgestational lethality. [provided by MGI curators]
Allele List at MGI

All alleles(134) : Targeted(7) Gene trapped(127)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg3 C T 8: 95,036,908 A279V probably benign Het
Aggf1 G A 13: 95,371,594 P88L probably benign Het
Asb18 T C 1: 89,968,689 T210A probably benign Het
Cd8b1 C T 6: 71,326,022 S27L possibly damaging Het
Cfap43 C T 19: 47,739,797 S1507N possibly damaging Het
Col12a1 A T 9: 79,639,965 probably null Het
Col19a1 G A 1: 24,534,109 T194M unknown Het
Cpb1 T A 3: 20,263,569 T237S probably benign Het
Cubn G A 2: 13,466,030 T517M probably damaging Het
Dnah6 T C 6: 73,129,291 N1769S probably benign Het
Dnm1 A G 2: 32,335,972 I365T probably damaging Het
E2f5 T A 3: 14,603,763 D238E probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gapvd1 C T 2: 34,728,735 V209I probably damaging Het
Gbp8 G A 5: 105,051,062 probably benign Het
Gprc6a T C 10: 51,628,543 I68M probably benign Het
Grb14 T C 2: 64,953,622 N54D probably damaging Het
Gucy2g A T 19: 55,237,837 F216I probably benign Het
Herc2 T A 7: 56,170,477 L2849Q probably damaging Het
Hsd17b4 G T 18: 50,128,314 probably benign Het
Igkv9-129 T A 6: 67,839,800 M3K probably damaging Het
Iqcd A T 5: 120,602,420 E272V probably damaging Het
Itih2 A T 2: 10,106,737 Y463* probably null Het
Kcna10 G A 3: 107,195,465 E471K possibly damaging Het
Klf3 A T 5: 64,829,004 E294V possibly damaging Het
Lancl1 A T 1: 67,020,856 probably null Het
Lrig3 T C 10: 126,011,008 F882L probably benign Het
Man2c1 A G 9: 57,139,083 N474S probably damaging Het
Map4k3 A G 17: 80,615,015 probably null Het
Mast1 C A 8: 84,920,891 W572C probably damaging Het
Mbd4 T A 6: 115,849,115 Q305L possibly damaging Het
Mbl2 T A 19: 30,239,516 S243T probably benign Het
Mcph1 C T 8: 18,632,541 P565S probably benign Het
Mfsd1 G C 3: 67,600,610 V435L probably benign Het
Mycbp2 C T 14: 103,123,445 G1183D probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Noa1 A T 5: 77,306,372 S474T probably benign Het
Nrde2 A G 12: 100,130,584 Y986H probably benign Het
Oca2 G T 7: 56,414,434 V726F possibly damaging Het
Olfr57 A T 10: 79,035,410 M205L probably benign Het
Olfr695 T A 7: 106,873,373 S291C probably damaging Het
Pip5k1a A G 3: 95,068,059 probably null Het
Plekhn1 A T 4: 156,225,273 probably null Het
Sec61a2 T C 2: 5,882,859 D104G probably benign Het
Slc25a36 T C 9: 97,085,118 T131A probably benign Het
Slc5a11 A T 7: 123,258,477 D263V probably damaging Het
Sorbs1 T C 19: 40,395,745 I35V probably benign Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Tbc1d1 T C 5: 64,173,670 V64A possibly damaging Het
Tmem159 T G 7: 120,115,491 F68V probably damaging Het
Ttc37 A T 13: 76,155,665 Y1234F probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn1r20 A G 6: 57,432,057 M123V probably benign Het
Zwint T C 10: 72,656,263 L59P probably damaging Het
Other mutations in Etv6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Etv6 APN 6 134248387 missense probably benign 0.41
IGL02028:Etv6 APN 6 134248733 missense probably benign 0.01
IGL02173:Etv6 APN 6 134248727 missense possibly damaging 0.68
IGL03074:Etv6 APN 6 134222925 missense probably damaging 0.98
R0056:Etv6 UTSW 6 134248534 nonsense probably null
R0295:Etv6 UTSW 6 134266275 missense probably benign 0.31
R2133:Etv6 UTSW 6 134248754 missense possibly damaging 0.92
R3763:Etv6 UTSW 6 134263012 splice site probably benign
R6901:Etv6 UTSW 6 134266458 missense probably benign 0.10
R8292:Etv6 UTSW 6 134248546 missense probably benign
R8343:Etv6 UTSW 6 134248754 missense possibly damaging 0.92
R8752:Etv6 UTSW 6 134266428 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACACAGCCCTGACATGTAGAG -3'
(R):5'- GCCACGTTTCCAAATGAAGAATG -3'

Sequencing Primer
(F):5'- CCCTGACATGTAGAGTCATACATAGG -3'
(R):5'- AAGTGAACTATTCAGCCCCTTG -3'
Posted On 2015-07-07