Incidental Mutation 'R4405:Mcph1'
ID327622
Institutional Source Beutler Lab
Gene Symbol Mcph1
Ensembl Gene ENSMUSG00000039842
Gene Namemicrocephaly, primary autosomal recessive 1
SynonymsBRIT1, D030046N04Rik, 5430437K10Rik
MMRRC Submission 041134-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4405 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location18595131-18803189 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 18632541 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 565 (P565S)
Ref Sequence ENSEMBL: ENSMUSP00000131616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039412] [ENSMUST00000124910] [ENSMUST00000133417] [ENSMUST00000141244] [ENSMUST00000146819]
Predicted Effect probably benign
Transcript: ENSMUST00000039412
AA Change: P565S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000037000
Gene: ENSMUSG00000039842
AA Change: P565S

DomainStartEndE-ValueType
BRCT 13 89 2.64e-4 SMART
coiled coil region 128 155 N/A INTRINSIC
Pfam:Microcephalin 224 597 1.2e-143 PFAM
BRCT 624 707 2.23e-2 SMART
BRCT 740 810 1.55e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124910
SMART Domains Protein: ENSMUSP00000131698
Gene: ENSMUSG00000039842

DomainStartEndE-ValueType
BRCT 13 89 2.64e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133417
SMART Domains Protein: ENSMUSP00000121636
Gene: ENSMUSG00000039842

DomainStartEndE-ValueType
coiled coil region 14 41 N/A INTRINSIC
Pfam:Microcephalin 136 256 2.4e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141244
SMART Domains Protein: ENSMUSP00000119267
Gene: ENSMUSG00000039842

DomainStartEndE-ValueType
Blast:BRCT 2 38 2e-9 BLAST
low complexity region 39 51 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146819
AA Change: P565S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000131616
Gene: ENSMUSG00000039842
AA Change: P565S

DomainStartEndE-ValueType
BRCT 13 89 2.64e-4 SMART
coiled coil region 128 155 N/A INTRINSIC
Pfam:Microcephalin 224 598 1.4e-168 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153133
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA damage response protein. The encoded protein may play a role in G2/M checkpoint arrest via maintenance of inhibitory phosphorylation of cyclin-dependent kinase 1. Mutations in this gene have been associated with primary autosomal recessive microcephaly 1 and premature chromosome condensation syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous null mice are born at a reduced rate and display male and female infertility and arrest of male meiosis. Mice homozygous for another knock-out allele exhibit microcephaly, infertility, decreased brain size, impaired neuroprogenitor proliferation and apoptosis, and mitosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg3 C T 8: 95,036,908 A279V probably benign Het
Aggf1 G A 13: 95,371,594 P88L probably benign Het
Asb18 T C 1: 89,968,689 T210A probably benign Het
Cd8b1 C T 6: 71,326,022 S27L possibly damaging Het
Cfap43 C T 19: 47,739,797 S1507N possibly damaging Het
Col12a1 A T 9: 79,639,965 probably null Het
Col19a1 G A 1: 24,534,109 T194M unknown Het
Cpb1 T A 3: 20,263,569 T237S probably benign Het
Cubn G A 2: 13,466,030 T517M probably damaging Het
Dnah6 T C 6: 73,129,291 N1769S probably benign Het
Dnm1 A G 2: 32,335,972 I365T probably damaging Het
E2f5 T A 3: 14,603,763 D238E probably benign Het
Etv6 A G 6: 134,233,534 E115G probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gapvd1 C T 2: 34,728,735 V209I probably damaging Het
Gbp8 G A 5: 105,051,062 probably benign Het
Gprc6a T C 10: 51,628,543 I68M probably benign Het
Grb14 T C 2: 64,953,622 N54D probably damaging Het
Gucy2g A T 19: 55,237,837 F216I probably benign Het
Herc2 T A 7: 56,170,477 L2849Q probably damaging Het
Hsd17b4 G T 18: 50,128,314 probably benign Het
Igkv9-129 T A 6: 67,839,800 M3K probably damaging Het
Iqcd A T 5: 120,602,420 E272V probably damaging Het
Itih2 A T 2: 10,106,737 Y463* probably null Het
Kcna10 G A 3: 107,195,465 E471K possibly damaging Het
Klf3 A T 5: 64,829,004 E294V possibly damaging Het
Lancl1 A T 1: 67,020,856 probably null Het
Lrig3 T C 10: 126,011,008 F882L probably benign Het
Man2c1 A G 9: 57,139,083 N474S probably damaging Het
Map4k3 A G 17: 80,615,015 probably null Het
Mast1 C A 8: 84,920,891 W572C probably damaging Het
Mbd4 T A 6: 115,849,115 Q305L possibly damaging Het
Mbl2 T A 19: 30,239,516 S243T probably benign Het
Mfsd1 G C 3: 67,600,610 V435L probably benign Het
Mycbp2 C T 14: 103,123,445 G1183D probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Noa1 A T 5: 77,306,372 S474T probably benign Het
Nrde2 A G 12: 100,130,584 Y986H probably benign Het
Oca2 G T 7: 56,414,434 V726F possibly damaging Het
Olfr57 A T 10: 79,035,410 M205L probably benign Het
Olfr695 T A 7: 106,873,373 S291C probably damaging Het
Pip5k1a A G 3: 95,068,059 probably null Het
Plekhn1 A T 4: 156,225,273 probably null Het
Sec61a2 T C 2: 5,882,859 D104G probably benign Het
Slc25a36 T C 9: 97,085,118 T131A probably benign Het
Slc5a11 A T 7: 123,258,477 D263V probably damaging Het
Sorbs1 T C 19: 40,395,745 I35V probably benign Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Tbc1d1 T C 5: 64,173,670 V64A possibly damaging Het
Tmem159 T G 7: 120,115,491 F68V probably damaging Het
Ttc37 A T 13: 76,155,665 Y1234F probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn1r20 A G 6: 57,432,057 M123V probably benign Het
Zwint T C 10: 72,656,263 L59P probably damaging Het
Other mutations in Mcph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Mcph1 APN 8 18632620 missense possibly damaging 0.95
IGL00816:Mcph1 APN 8 18632397 missense possibly damaging 0.59
IGL01432:Mcph1 APN 8 18625639 missense probably damaging 0.99
IGL01674:Mcph1 APN 8 18631519 missense probably damaging 1.00
IGL01746:Mcph1 APN 8 18671127 missense probably damaging 1.00
IGL01788:Mcph1 APN 8 18632403 missense probably damaging 1.00
IGL01788:Mcph1 APN 8 18632404 missense probably damaging 1.00
IGL02185:Mcph1 APN 8 18668990 splice site probably benign
IGL02677:Mcph1 APN 8 18625593 missense probably damaging 1.00
IGL03376:Mcph1 APN 8 18596973 missense probably damaging 0.99
PIT4514001:Mcph1 UTSW 8 18631890 missense probably damaging 0.99
R0116:Mcph1 UTSW 8 18788248 missense probably benign 0.06
R0189:Mcph1 UTSW 8 18788471 missense probably damaging 0.96
R1510:Mcph1 UTSW 8 18632687 intron probably null
R1547:Mcph1 UTSW 8 18622686 missense possibly damaging 0.65
R1574:Mcph1 UTSW 8 18801412 missense probably damaging 0.99
R1574:Mcph1 UTSW 8 18801412 missense probably damaging 0.99
R1733:Mcph1 UTSW 8 18631963 missense probably benign 0.18
R1742:Mcph1 UTSW 8 18607363 missense probably benign 0.03
R1975:Mcph1 UTSW 8 18689065 splice site probably benign
R3836:Mcph1 UTSW 8 18622659 missense possibly damaging 0.91
R4493:Mcph1 UTSW 8 18631736 nonsense probably null
R4824:Mcph1 UTSW 8 18632687 intron probably null
R4873:Mcph1 UTSW 8 18625558 critical splice acceptor site probably null
R4875:Mcph1 UTSW 8 18625558 critical splice acceptor site probably null
R5125:Mcph1 UTSW 8 18607326 missense probably damaging 0.98
R5178:Mcph1 UTSW 8 18607326 missense probably damaging 0.98
R5217:Mcph1 UTSW 8 18788473 missense probably damaging 0.99
R5233:Mcph1 UTSW 8 18671238 missense probably damaging 0.96
R5299:Mcph1 UTSW 8 18652580 intron probably benign
R5335:Mcph1 UTSW 8 18689061 critical splice donor site probably null
R5579:Mcph1 UTSW 8 18632293 missense probably benign 0.18
R5621:Mcph1 UTSW 8 18632170 missense probably damaging 1.00
R5655:Mcph1 UTSW 8 18788310 missense probably benign 0.02
R5721:Mcph1 UTSW 8 18671207 missense probably damaging 0.99
R6076:Mcph1 UTSW 8 18631999 missense probably benign 0.40
R6592:Mcph1 UTSW 8 18668967 missense probably damaging 0.97
R7269:Mcph1 UTSW 8 18607272 splice site probably null
R7446:Mcph1 UTSW 8 18671093 missense probably benign 0.00
R7455:Mcph1 UTSW 8 18631759 missense probably benign 0.26
R7542:Mcph1 UTSW 8 18631689 missense probably benign 0.03
R7640:Mcph1 UTSW 8 18632326 missense probably benign 0.00
R7703:Mcph1 UTSW 8 18671106 missense possibly damaging 0.82
RF002:Mcph1 UTSW 8 18652529 small insertion probably benign
RF035:Mcph1 UTSW 8 18652525 small insertion probably benign
RF059:Mcph1 UTSW 8 18652525 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TCAGCTGAGGGATGACACAG -3'
(R):5'- CCTATCCCTCAAGAGCATCATTGG -3'

Sequencing Primer
(F):5'- TGACACAGGCCCAGAGG -3'
(R):5'- CCTCAAGAGCATCATTGGAAATATC -3'
Posted On2015-07-07