Incidental Mutation 'R4405:Slc25a36'
ID327627
Institutional Source Beutler Lab
Gene Symbol Slc25a36
Ensembl Gene ENSMUSG00000032449
Gene Namesolute carrier family 25, member 36
SynonymsC330005L02Rik
MMRRC Submission 041134-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R4405 (G1)
Quality Score168
Status Not validated
Chromosome9
Chromosomal Location97074961-97111157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97085118 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 131 (T131A)
Ref Sequence ENSEMBL: ENSMUSP00000082302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035024] [ENSMUST00000085206] [ENSMUST00000124250] [ENSMUST00000153070]
Predicted Effect probably benign
Transcript: ENSMUST00000035024
SMART Domains Protein: ENSMUSP00000035024
Gene: ENSMUSG00000032449

DomainStartEndE-ValueType
Pfam:Mito_carr 4 69 1.1e-12 PFAM
Pfam:Mito_carr 83 172 2.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085206
AA Change: T131A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000082302
Gene: ENSMUSG00000032449
AA Change: T131A

DomainStartEndE-ValueType
Pfam:Mito_carr 2 113 9.5e-27 PFAM
Pfam:Mito_carr 114 207 2.5e-23 PFAM
Pfam:Mito_carr 222 311 6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124250
SMART Domains Protein: ENSMUSP00000119696
Gene: ENSMUSG00000032449

DomainStartEndE-ValueType
Pfam:Mito_carr 1 93 3.6e-23 PFAM
low complexity region 102 115 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148995
Predicted Effect probably benign
Transcript: ENSMUST00000153070
SMART Domains Protein: ENSMUSP00000116813
Gene: ENSMUSG00000032449

DomainStartEndE-ValueType
Pfam:Mito_carr 2 113 5.8e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155291
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg3 C T 8: 95,036,908 A279V probably benign Het
Aggf1 G A 13: 95,371,594 P88L probably benign Het
Asb18 T C 1: 89,968,689 T210A probably benign Het
Cd8b1 C T 6: 71,326,022 S27L possibly damaging Het
Cfap43 C T 19: 47,739,797 S1507N possibly damaging Het
Col12a1 A T 9: 79,639,965 probably null Het
Col19a1 G A 1: 24,534,109 T194M unknown Het
Cpb1 T A 3: 20,263,569 T237S probably benign Het
Cubn G A 2: 13,466,030 T517M probably damaging Het
Dnah6 T C 6: 73,129,291 N1769S probably benign Het
Dnm1 A G 2: 32,335,972 I365T probably damaging Het
E2f5 T A 3: 14,603,763 D238E probably benign Het
Etv6 A G 6: 134,233,534 E115G probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gapvd1 C T 2: 34,728,735 V209I probably damaging Het
Gbp8 G A 5: 105,051,062 probably benign Het
Gprc6a T C 10: 51,628,543 I68M probably benign Het
Grb14 T C 2: 64,953,622 N54D probably damaging Het
Gucy2g A T 19: 55,237,837 F216I probably benign Het
Herc2 T A 7: 56,170,477 L2849Q probably damaging Het
Hsd17b4 G T 18: 50,128,314 probably benign Het
Igkv9-129 T A 6: 67,839,800 M3K probably damaging Het
Iqcd A T 5: 120,602,420 E272V probably damaging Het
Itih2 A T 2: 10,106,737 Y463* probably null Het
Kcna10 G A 3: 107,195,465 E471K possibly damaging Het
Klf3 A T 5: 64,829,004 E294V possibly damaging Het
Lancl1 A T 1: 67,020,856 probably null Het
Lrig3 T C 10: 126,011,008 F882L probably benign Het
Man2c1 A G 9: 57,139,083 N474S probably damaging Het
Map4k3 A G 17: 80,615,015 probably null Het
Mast1 C A 8: 84,920,891 W572C probably damaging Het
Mbd4 T A 6: 115,849,115 Q305L possibly damaging Het
Mbl2 T A 19: 30,239,516 S243T probably benign Het
Mcph1 C T 8: 18,632,541 P565S probably benign Het
Mfsd1 G C 3: 67,600,610 V435L probably benign Het
Mycbp2 C T 14: 103,123,445 G1183D probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Noa1 A T 5: 77,306,372 S474T probably benign Het
Nrde2 A G 12: 100,130,584 Y986H probably benign Het
Oca2 G T 7: 56,414,434 V726F possibly damaging Het
Olfr57 A T 10: 79,035,410 M205L probably benign Het
Olfr695 T A 7: 106,873,373 S291C probably damaging Het
Pip5k1a A G 3: 95,068,059 probably null Het
Plekhn1 A T 4: 156,225,273 probably null Het
Sec61a2 T C 2: 5,882,859 D104G probably benign Het
Slc5a11 A T 7: 123,258,477 D263V probably damaging Het
Sorbs1 T C 19: 40,395,745 I35V probably benign Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Tbc1d1 T C 5: 64,173,670 V64A possibly damaging Het
Tmem159 T G 7: 120,115,491 F68V probably damaging Het
Ttc37 A T 13: 76,155,665 Y1234F probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn1r20 A G 6: 57,432,057 M123V probably benign Het
Zwint T C 10: 72,656,263 L59P probably damaging Het
Other mutations in Slc25a36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01552:Slc25a36 APN 9 97079233 missense probably benign 0.01
IGL01634:Slc25a36 APN 9 97080481 missense probably benign 0.00
IGL02149:Slc25a36 APN 9 97093069 splice site probably benign
R0394:Slc25a36 UTSW 9 97080204 missense probably benign 0.36
R0518:Slc25a36 UTSW 9 97097175 missense probably damaging 1.00
R1024:Slc25a36 UTSW 9 97079201 missense probably damaging 1.00
R1208:Slc25a36 UTSW 9 97085135 splice site probably benign
R1439:Slc25a36 UTSW 9 97093073 splice site probably benign
R1466:Slc25a36 UTSW 9 97080355 missense probably damaging 1.00
R1466:Slc25a36 UTSW 9 97080355 missense probably damaging 1.00
R1920:Slc25a36 UTSW 9 97093082 missense probably benign 0.00
R2247:Slc25a36 UTSW 9 97100138 missense probably damaging 1.00
R2317:Slc25a36 UTSW 9 97079182 missense probably damaging 1.00
R2518:Slc25a36 UTSW 9 97079071 missense possibly damaging 0.95
R3756:Slc25a36 UTSW 9 97100155 nonsense probably null
R4624:Slc25a36 UTSW 9 97079125 missense probably damaging 0.99
R4719:Slc25a36 UTSW 9 97090119 utr 3 prime probably benign
R5492:Slc25a36 UTSW 9 97100206 missense probably damaging 1.00
R6152:Slc25a36 UTSW 9 97100157 missense probably damaging 1.00
R7823:Slc25a36 UTSW 9 97084391 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTGCCCTGCTTAAAGCCTG -3'
(R):5'- AACAGGTGTTCATGGTCACTAG -3'

Sequencing Primer
(F):5'- CTCCTGGCATACAAGTGTACATG -3'
(R):5'- GAACATAAAATGAAAAGTGTGAAGCC -3'
Posted On2015-07-07