Incidental Mutation 'R4405:Gprc6a'
ID327629
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene NameG protein-coupled receptor, family C, group 6, member A
Synonyms
MMRRC Submission 041134-MU
Accession Numbers

Ncbi RefSeq: NM_153071.1; MGI:2429498

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4405 (G1)
Quality Score216
Status Not validated
Chromosome10
Chromosomal Location51614823-51631461 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51628543 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 68 (I68M)
Ref Sequence ENSEMBL: ENSMUSP00000151341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]
Predicted Effect probably benign
Transcript: ENSMUST00000020062
AA Change: I68M

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905
AA Change: I68M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218684
AA Change: I68M

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000219286
AA Change: I68M

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.0967 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype Strain: 3831176
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg3 C T 8: 95,036,908 A279V probably benign Het
Aggf1 G A 13: 95,371,594 P88L probably benign Het
Asb18 T C 1: 89,968,689 T210A probably benign Het
Cd8b1 C T 6: 71,326,022 S27L possibly damaging Het
Cfap43 C T 19: 47,739,797 S1507N possibly damaging Het
Col12a1 A T 9: 79,639,965 probably null Het
Col19a1 G A 1: 24,534,109 T194M unknown Het
Cpb1 T A 3: 20,263,569 T237S probably benign Het
Cubn G A 2: 13,466,030 T517M probably damaging Het
Dnah6 T C 6: 73,129,291 N1769S probably benign Het
Dnm1 A G 2: 32,335,972 I365T probably damaging Het
E2f5 T A 3: 14,603,763 D238E probably benign Het
Etv6 A G 6: 134,233,534 E115G probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gapvd1 C T 2: 34,728,735 V209I probably damaging Het
Gbp8 G A 5: 105,051,062 probably benign Het
Grb14 T C 2: 64,953,622 N54D probably damaging Het
Gucy2g A T 19: 55,237,837 F216I probably benign Het
Herc2 T A 7: 56,170,477 L2849Q probably damaging Het
Hsd17b4 G T 18: 50,128,314 probably benign Het
Igkv9-129 T A 6: 67,839,800 M3K probably damaging Het
Iqcd A T 5: 120,602,420 E272V probably damaging Het
Itih2 A T 2: 10,106,737 Y463* probably null Het
Kcna10 G A 3: 107,195,465 E471K possibly damaging Het
Klf3 A T 5: 64,829,004 E294V possibly damaging Het
Lancl1 A T 1: 67,020,856 probably null Het
Lrig3 T C 10: 126,011,008 F882L probably benign Het
Man2c1 A G 9: 57,139,083 N474S probably damaging Het
Map4k3 A G 17: 80,615,015 probably null Het
Mast1 C A 8: 84,920,891 W572C probably damaging Het
Mbd4 T A 6: 115,849,115 Q305L possibly damaging Het
Mbl2 T A 19: 30,239,516 S243T probably benign Het
Mcph1 C T 8: 18,632,541 P565S probably benign Het
Mfsd1 G C 3: 67,600,610 V435L probably benign Het
Mycbp2 C T 14: 103,123,445 G1183D probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Noa1 A T 5: 77,306,372 S474T probably benign Het
Nrde2 A G 12: 100,130,584 Y986H probably benign Het
Oca2 G T 7: 56,414,434 V726F possibly damaging Het
Olfr57 A T 10: 79,035,410 M205L probably benign Het
Olfr695 T A 7: 106,873,373 S291C probably damaging Het
Pip5k1a A G 3: 95,068,059 probably null Het
Plekhn1 A T 4: 156,225,273 probably null Het
Sec61a2 T C 2: 5,882,859 D104G probably benign Het
Slc25a36 T C 9: 97,085,118 T131A probably benign Het
Slc5a11 A T 7: 123,258,477 D263V probably damaging Het
Sorbs1 T C 19: 40,395,745 I35V probably benign Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Tbc1d1 T C 5: 64,173,670 V64A possibly damaging Het
Tmem159 T G 7: 120,115,491 F68V probably damaging Het
Ttc37 A T 13: 76,155,665 Y1234F probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn1r20 A G 6: 57,432,057 M123V probably benign Het
Zwint T C 10: 72,656,263 L59P probably damaging Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51615430 missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51627084 missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51626723 missense probably benign
IGL02317:Gprc6a APN 10 51620953 missense probably benign 0.01
IGL02995:Gprc6a APN 10 51626799 missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51616603 missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51628349 missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51615872 missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51615259 missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51628437 missense probably benign 0.01
R1831:Gprc6a UTSW 10 51615806 missense probably benign 0.22
R2108:Gprc6a UTSW 10 51615208 missense probably damaging 1.00
R2159:Gprc6a UTSW 10 51615680 frame shift probably null
R2160:Gprc6a UTSW 10 51615680 frame shift probably null
R2162:Gprc6a UTSW 10 51615680 frame shift probably null
R2229:Gprc6a UTSW 10 51626795 missense possibly damaging 0.50
R3009:Gprc6a UTSW 10 51628296 missense probably benign 0.02
R3709:Gprc6a UTSW 10 51615680 frame shift probably null
R3710:Gprc6a UTSW 10 51615680 frame shift probably null
R3737:Gprc6a UTSW 10 51626911 missense probably benign
R3914:Gprc6a UTSW 10 51628275 missense probably benign 0.00
R3918:Gprc6a UTSW 10 51615680 frame shift probably null
R3964:Gprc6a UTSW 10 51615680 frame shift probably null
R3965:Gprc6a UTSW 10 51615680 frame shift probably null
R3966:Gprc6a UTSW 10 51615680 frame shift probably null
R3973:Gprc6a UTSW 10 51628448 missense possibly damaging 0.93
R3977:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3978:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3979:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R4306:Gprc6a UTSW 10 51616639 missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4408:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4713:Gprc6a UTSW 10 51631457 unclassified probably benign
R4788:Gprc6a UTSW 10 51615008 missense probably benign 0.00
R5248:Gprc6a UTSW 10 51614993 missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51626804 missense probably damaging 1.00
R5436:Gprc6a UTSW 10 51626702 missense probably benign
R5721:Gprc6a UTSW 10 51614980 missense probably benign 0.06
R6061:Gprc6a UTSW 10 51615811 missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51615077 missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51615260 missense possibly damaging 0.89
R6162:Gprc6a UTSW 10 51614912 missense probably benign 0.44
R6207:Gprc6a UTSW 10 51626835 missense probably benign 0.36
R6497:Gprc6a UTSW 10 51615701 missense probably benign 0.05
R6717:Gprc6a UTSW 10 51615137 missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51631316 missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51626745 nonsense probably null
R7000:Gprc6a UTSW 10 51615047 missense probably benign 0.34
R7019:Gprc6a UTSW 10 51631412 missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51614890 missense probably benign
R7173:Gprc6a UTSW 10 51628499 missense probably benign 0.01
R7579:Gprc6a UTSW 10 51626787 missense probably benign
R7736:Gprc6a UTSW 10 51615453 missense possibly damaging 0.82
Z1177:Gprc6a UTSW 10 51615209 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTTGACCCTTGGCATGTAGC -3'
(R):5'- TCTGCTAAAACTTATGATCAGGGG -3'

Sequencing Primer
(F):5'- AGACCACAGTTTCTCTAGAGCAGTTG -3'
(R):5'- GACAGAGACATGGTTGAGAT -3'
Posted On2015-07-07