Incidental Mutation 'R4405:Olfr57'
ID327631
Institutional Source Beutler Lab
Gene Symbol Olfr57
Ensembl Gene ENSMUSG00000060205
Gene Nameolfactory receptor 57
SynonymsGA_x6K02T2QGN0-2777431-2776472, IF12, MOR139-3
MMRRC Submission 041134-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R4405 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location79028741-79036274 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79035410 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 205 (M205L)
Ref Sequence ENSEMBL: ENSMUSP00000144814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082244] [ENSMUST00000203906]
Predicted Effect probably benign
Transcript: ENSMUST00000082244
AA Change: M205L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080872
Gene: ENSMUSG00000060205
AA Change: M205L

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.2e-49 PFAM
Pfam:7tm_1 42 291 6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203906
AA Change: M205L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144814
Gene: ENSMUSG00000060205
AA Change: M205L

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
Pfam:7tm_4 32 308 2e-49 PFAM
Pfam:7tm_1 42 291 1.9e-23 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg3 C T 8: 95,036,908 A279V probably benign Het
Aggf1 G A 13: 95,371,594 P88L probably benign Het
Asb18 T C 1: 89,968,689 T210A probably benign Het
Cd8b1 C T 6: 71,326,022 S27L possibly damaging Het
Cfap43 C T 19: 47,739,797 S1507N possibly damaging Het
Col12a1 A T 9: 79,639,965 probably null Het
Col19a1 G A 1: 24,534,109 T194M unknown Het
Cpb1 T A 3: 20,263,569 T237S probably benign Het
Cubn G A 2: 13,466,030 T517M probably damaging Het
Dnah6 T C 6: 73,129,291 N1769S probably benign Het
Dnm1 A G 2: 32,335,972 I365T probably damaging Het
E2f5 T A 3: 14,603,763 D238E probably benign Het
Etv6 A G 6: 134,233,534 E115G probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gapvd1 C T 2: 34,728,735 V209I probably damaging Het
Gbp8 G A 5: 105,051,062 probably benign Het
Gprc6a T C 10: 51,628,543 I68M probably benign Het
Grb14 T C 2: 64,953,622 N54D probably damaging Het
Gucy2g A T 19: 55,237,837 F216I probably benign Het
Herc2 T A 7: 56,170,477 L2849Q probably damaging Het
Hsd17b4 G T 18: 50,128,314 probably benign Het
Igkv9-129 T A 6: 67,839,800 M3K probably damaging Het
Iqcd A T 5: 120,602,420 E272V probably damaging Het
Itih2 A T 2: 10,106,737 Y463* probably null Het
Kcna10 G A 3: 107,195,465 E471K possibly damaging Het
Klf3 A T 5: 64,829,004 E294V possibly damaging Het
Lancl1 A T 1: 67,020,856 probably null Het
Lrig3 T C 10: 126,011,008 F882L probably benign Het
Man2c1 A G 9: 57,139,083 N474S probably damaging Het
Map4k3 A G 17: 80,615,015 probably null Het
Mast1 C A 8: 84,920,891 W572C probably damaging Het
Mbd4 T A 6: 115,849,115 Q305L possibly damaging Het
Mbl2 T A 19: 30,239,516 S243T probably benign Het
Mcph1 C T 8: 18,632,541 P565S probably benign Het
Mfsd1 G C 3: 67,600,610 V435L probably benign Het
Mycbp2 C T 14: 103,123,445 G1183D probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Noa1 A T 5: 77,306,372 S474T probably benign Het
Nrde2 A G 12: 100,130,584 Y986H probably benign Het
Oca2 G T 7: 56,414,434 V726F possibly damaging Het
Olfr695 T A 7: 106,873,373 S291C probably damaging Het
Pip5k1a A G 3: 95,068,059 probably null Het
Plekhn1 A T 4: 156,225,273 probably null Het
Sec61a2 T C 2: 5,882,859 D104G probably benign Het
Slc25a36 T C 9: 97,085,118 T131A probably benign Het
Slc5a11 A T 7: 123,258,477 D263V probably damaging Het
Sorbs1 T C 19: 40,395,745 I35V probably benign Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Tbc1d1 T C 5: 64,173,670 V64A possibly damaging Het
Tmem159 T G 7: 120,115,491 F68V probably damaging Het
Ttc37 A T 13: 76,155,665 Y1234F probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn1r20 A G 6: 57,432,057 M123V probably benign Het
Zwint T C 10: 72,656,263 L59P probably damaging Het
Other mutations in Olfr57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Olfr57 APN 10 79035611 missense probably benign 0.05
IGL02230:Olfr57 APN 10 79035042 missense probably damaging 0.99
IGL02283:Olfr57 APN 10 79035545 missense probably damaging 1.00
IGL02878:Olfr57 APN 10 79035558 missense probably benign 0.23
IGL02975:Olfr57 APN 10 79035033 missense possibly damaging 0.83
IGL03259:Olfr57 APN 10 79035400 nonsense probably null
R1366:Olfr57 UTSW 10 79035042 missense probably damaging 1.00
R1438:Olfr57 UTSW 10 79035288 missense possibly damaging 0.88
R1528:Olfr57 UTSW 10 79035564 missense probably damaging 0.96
R1601:Olfr57 UTSW 10 79035504 missense possibly damaging 0.56
R2032:Olfr57 UTSW 10 79035329 missense possibly damaging 0.86
R2112:Olfr57 UTSW 10 79035414 missense probably damaging 1.00
R2382:Olfr57 UTSW 10 79035134 missense possibly damaging 0.52
R2967:Olfr57 UTSW 10 79035053 missense probably damaging 1.00
R3773:Olfr57 UTSW 10 79035180 missense possibly damaging 0.95
R3940:Olfr57 UTSW 10 79035204 missense probably damaging 1.00
R5944:Olfr57 UTSW 10 79035389 missense probably benign 0.00
R6563:Olfr57 UTSW 10 79035217 missense possibly damaging 0.67
R6614:Olfr57 UTSW 10 79035091 nonsense probably null
R7181:Olfr57 UTSW 10 79035453 missense probably damaging 0.98
R7639:Olfr57 UTSW 10 79035372 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCATCATGAGCACAAGACGC -3'
(R):5'- GTTTTGGGTCACAGCAGAGC -3'

Sequencing Primer
(F):5'- CACAAGACGCTGTGGATTGATGATTC -3'
(R):5'- AGAGCTGAGGTACACTCCCAG -3'
Posted On2015-07-07