Incidental Mutation 'R4405:Gucy2g'
ID327643
Institutional Source Beutler Lab
Gene Symbol Gucy2g
Ensembl Gene ENSMUSG00000055523
Gene Nameguanylate cyclase 2g
SynonymsGC-G, 2410077I05Rik
MMRRC Submission 041134-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4405 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location55198297-55241236 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55237837 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 216 (F216I)
Ref Sequence ENSEMBL: ENSMUSP00000068253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069183]
Predicted Effect probably benign
Transcript: ENSMUST00000069183
AA Change: F216I

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000068253
Gene: ENSMUSG00000055523
AA Change: F216I

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
Pfam:ANF_receptor 65 416 5.2e-36 PFAM
low complexity region 471 487 N/A INTRINSIC
Pfam:Pkinase 574 826 2e-26 PFAM
Pfam:Pkinase_Tyr 577 826 6e-35 PFAM
CYCc 865 1059 6.42e-96 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no gross abnormalities and are protected against acute ischemia induced renal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg3 C T 8: 95,036,908 A279V probably benign Het
Aggf1 G A 13: 95,371,594 P88L probably benign Het
Asb18 T C 1: 89,968,689 T210A probably benign Het
Cd8b1 C T 6: 71,326,022 S27L possibly damaging Het
Cfap43 C T 19: 47,739,797 S1507N possibly damaging Het
Col12a1 A T 9: 79,639,965 probably null Het
Col19a1 G A 1: 24,534,109 T194M unknown Het
Cpb1 T A 3: 20,263,569 T237S probably benign Het
Cubn G A 2: 13,466,030 T517M probably damaging Het
Dnah6 T C 6: 73,129,291 N1769S probably benign Het
Dnm1 A G 2: 32,335,972 I365T probably damaging Het
E2f5 T A 3: 14,603,763 D238E probably benign Het
Etv6 A G 6: 134,233,534 E115G probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gapvd1 C T 2: 34,728,735 V209I probably damaging Het
Gbp8 G A 5: 105,051,062 probably benign Het
Gprc6a T C 10: 51,628,543 I68M probably benign Het
Grb14 T C 2: 64,953,622 N54D probably damaging Het
Herc2 T A 7: 56,170,477 L2849Q probably damaging Het
Hsd17b4 G T 18: 50,128,314 probably benign Het
Igkv9-129 T A 6: 67,839,800 M3K probably damaging Het
Iqcd A T 5: 120,602,420 E272V probably damaging Het
Itih2 A T 2: 10,106,737 Y463* probably null Het
Kcna10 G A 3: 107,195,465 E471K possibly damaging Het
Klf3 A T 5: 64,829,004 E294V possibly damaging Het
Lancl1 A T 1: 67,020,856 probably null Het
Lrig3 T C 10: 126,011,008 F882L probably benign Het
Man2c1 A G 9: 57,139,083 N474S probably damaging Het
Map4k3 A G 17: 80,615,015 probably null Het
Mast1 C A 8: 84,920,891 W572C probably damaging Het
Mbd4 T A 6: 115,849,115 Q305L possibly damaging Het
Mbl2 T A 19: 30,239,516 S243T probably benign Het
Mcph1 C T 8: 18,632,541 P565S probably benign Het
Mfsd1 G C 3: 67,600,610 V435L probably benign Het
Mycbp2 C T 14: 103,123,445 G1183D probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Noa1 A T 5: 77,306,372 S474T probably benign Het
Nrde2 A G 12: 100,130,584 Y986H probably benign Het
Oca2 G T 7: 56,414,434 V726F possibly damaging Het
Olfr57 A T 10: 79,035,410 M205L probably benign Het
Olfr695 T A 7: 106,873,373 S291C probably damaging Het
Pip5k1a A G 3: 95,068,059 probably null Het
Plekhn1 A T 4: 156,225,273 probably null Het
Sec61a2 T C 2: 5,882,859 D104G probably benign Het
Slc25a36 T C 9: 97,085,118 T131A probably benign Het
Slc5a11 A T 7: 123,258,477 D263V probably damaging Het
Sorbs1 T C 19: 40,395,745 I35V probably benign Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Tbc1d1 T C 5: 64,173,670 V64A possibly damaging Het
Tmem159 T G 7: 120,115,491 F68V probably damaging Het
Ttc37 A T 13: 76,155,665 Y1234F probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn1r20 A G 6: 57,432,057 M123V probably benign Het
Zwint T C 10: 72,656,263 L59P probably damaging Het
Other mutations in Gucy2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Gucy2g APN 19 55233103 missense probably benign 0.01
IGL01954:Gucy2g APN 19 55198691 missense probably benign 0.01
IGL01969:Gucy2g APN 19 55227438 missense probably benign 0.00
IGL02164:Gucy2g APN 19 55238023 missense probably benign
IGL02534:Gucy2g APN 19 55241068 missense probably damaging 1.00
IGL02667:Gucy2g APN 19 55206177 missense possibly damaging 0.64
IGL02755:Gucy2g APN 19 55210354 missense probably benign 0.10
IGL03187:Gucy2g APN 19 55231052 missense possibly damaging 0.91
IGL03354:Gucy2g APN 19 55233080 missense possibly damaging 0.95
PIT4366001:Gucy2g UTSW 19 55237782 missense probably null 0.51
R0040:Gucy2g UTSW 19 55217302 missense possibly damaging 0.73
R0126:Gucy2g UTSW 19 55241166 missense probably benign
R0318:Gucy2g UTSW 19 55237798 missense probably benign 0.00
R0576:Gucy2g UTSW 19 55198770 missense probably damaging 1.00
R0604:Gucy2g UTSW 19 55203087 missense probably benign 0.00
R0962:Gucy2g UTSW 19 55210284 nonsense probably null
R1348:Gucy2g UTSW 19 55222906 missense possibly damaging 0.68
R1458:Gucy2g UTSW 19 55215036 splice site probably benign
R1693:Gucy2g UTSW 19 55222926 missense probably damaging 1.00
R1795:Gucy2g UTSW 19 55199541 missense probably damaging 1.00
R1804:Gucy2g UTSW 19 55210309 missense probably benign 0.34
R1830:Gucy2g UTSW 19 55222930 missense possibly damaging 0.94
R1902:Gucy2g UTSW 19 55210237 missense probably benign 0.20
R1927:Gucy2g UTSW 19 55237759 missense probably benign 0.02
R1969:Gucy2g UTSW 19 55222896 missense possibly damaging 0.90
R1969:Gucy2g UTSW 19 55233053 missense probably benign 0.42
R2071:Gucy2g UTSW 19 55222340 missense possibly damaging 0.72
R2842:Gucy2g UTSW 19 55240947 missense probably damaging 1.00
R2971:Gucy2g UTSW 19 55210276 missense probably damaging 1.00
R4202:Gucy2g UTSW 19 55229769 missense possibly damaging 0.96
R4407:Gucy2g UTSW 19 55237837 missense probably benign 0.08
R4614:Gucy2g UTSW 19 55202147 nonsense probably null
R4671:Gucy2g UTSW 19 55238068 missense probably damaging 1.00
R4684:Gucy2g UTSW 19 55206256 missense probably damaging 1.00
R4837:Gucy2g UTSW 19 55226053 missense probably benign
R4969:Gucy2g UTSW 19 55226013 missense probably benign
R5050:Gucy2g UTSW 19 55240935 missense probably benign 0.05
R5059:Gucy2g UTSW 19 55226071 missense probably benign 0.00
R5070:Gucy2g UTSW 19 55229787 missense probably damaging 0.98
R5288:Gucy2g UTSW 19 55215116 missense probably damaging 1.00
R5384:Gucy2g UTSW 19 55215116 missense probably damaging 1.00
R5386:Gucy2g UTSW 19 55215116 missense probably damaging 1.00
R5497:Gucy2g UTSW 19 55198701 missense probably benign 0.00
R5531:Gucy2g UTSW 19 55241140 missense probably benign 0.24
R5536:Gucy2g UTSW 19 55237927 missense probably benign 0.05
R5679:Gucy2g UTSW 19 55231079 missense possibly damaging 0.87
R5715:Gucy2g UTSW 19 55233155 missense possibly damaging 0.93
R5941:Gucy2g UTSW 19 55215131 missense probably damaging 1.00
R6250:Gucy2g UTSW 19 55217424 missense probably damaging 0.99
R6288:Gucy2g UTSW 19 55227513 missense probably benign 0.01
R6378:Gucy2g UTSW 19 55240945 missense probably benign 0.00
R6605:Gucy2g UTSW 19 55241028 missense probably damaging 1.00
R7020:Gucy2g UTSW 19 55233050 missense probably damaging 0.98
R7064:Gucy2g UTSW 19 55210332 missense probably benign 0.01
R7078:Gucy2g UTSW 19 55241151 missense probably damaging 1.00
R7402:Gucy2g UTSW 19 55206293 missense probably damaging 1.00
R7539:Gucy2g UTSW 19 55203154 missense probably damaging 0.99
R7561:Gucy2g UTSW 19 55206340 missense probably benign 0.38
R7583:Gucy2g UTSW 19 55235615 missense probably damaging 1.00
R7804:Gucy2g UTSW 19 55228152 missense probably benign 0.02
R7880:Gucy2g UTSW 19 55206280 missense probably damaging 1.00
R8442:Gucy2g UTSW 19 55217401 missense probably benign 0.00
R8559:Gucy2g UTSW 19 55210354 missense probably benign 0.10
Z1177:Gucy2g UTSW 19 55210377 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAAGCTTTGCAGGAGTTTGC -3'
(R):5'- TGACACCTGCGTGACACTTG -3'

Sequencing Primer
(F):5'- GCAGGAGTTTGCTTCTAGAACTTAC -3'
(R):5'- GTGACACTTGTGCCACCCAAG -3'
Posted On2015-07-07